Incidental Mutation 'R7135:Cspp1'
ID552963
Institutional Source Beutler Lab
Gene Symbol Cspp1
Ensembl Gene ENSMUSG00000056763
Gene Namecentrosome and spindle pole associated protein 1
Synonyms2310020J12Rik, 4930413O22Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.339) question?
Stock #R7135 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location10037987-10136768 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 10088936 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 529 (T529I)
Ref Sequence ENSEMBL: ENSMUSP00000068804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071087] [ENSMUST00000186294]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071087
AA Change: T529I

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000068804
Gene: ENSMUSG00000056763
AA Change: T529I

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
low complexity region 270 285 N/A INTRINSIC
coiled coil region 349 383 N/A INTRINSIC
low complexity region 426 447 N/A INTRINSIC
low complexity region 465 484 N/A INTRINSIC
coiled coil region 568 610 N/A INTRINSIC
Pfam:CCDC66 661 810 2e-11 PFAM
coiled coil region 866 903 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000186294
AA Change: T525I

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000139775
Gene: ENSMUSG00000056763
AA Change: T525I

DomainStartEndE-ValueType
low complexity region 266 281 N/A INTRINSIC
coiled coil region 345 379 N/A INTRINSIC
low complexity region 422 443 N/A INTRINSIC
low complexity region 461 480 N/A INTRINSIC
SCOP:d1eq1a_ 567 748 4e-3 SMART
coiled coil region 811 848 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188449
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosome and spindle pole associated protein. The encoded protein plays a role in cell-cycle progression and spindle organization, regulates cytokinesis, interacts with Nephrocystin 8 and is required for cilia formation. Mutations in this gene result in primary cilia abnormalities and classical Joubert syndrome. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016G14Rik T C 13: 24,741,506 S78P probably benign Het
Aars2 T A 17: 45,508,961 Y221* probably null Het
Ankmy2 T C 12: 36,196,312 S412P probably benign Het
Ap1s3 T C 1: 79,609,202 T144A probably benign Het
Asb3 T A 11: 30,998,501 L59* probably null Het
Asxl3 G T 18: 22,517,701 G916* probably null Het
Asxl3 G C 18: 22,517,702 G916A probably damaging Het
Birc2 A C 9: 7,818,761 F610V probably damaging Het
Camk4 G A 18: 33,107,943 probably null Het
Ccdc162 A G 10: 41,673,859 S343P probably benign Het
Ccnk T A 12: 108,186,475 L17Q probably damaging Het
Cd59b G A 2: 104,084,447 W63* probably null Het
Chrm3 C T 13: 9,877,801 V400I probably benign Het
Crb1 C A 1: 139,243,367 V762F probably damaging Het
Cttnbp2 A G 6: 18,448,447 I71T possibly damaging Het
Cyb561 C A 11: 105,935,567 G90V probably damaging Het
Cyld T A 8: 88,744,892 D804E possibly damaging Het
Ddx31 G A 2: 28,848,306 V160I probably benign Het
Dgkg T C 16: 22,500,382 D643G probably damaging Het
Dnah12 G A 14: 26,778,912 probably null Het
Dnah12 T G 14: 26,801,413 I1953S probably damaging Het
Dnah7b T C 1: 46,139,710 W848R probably damaging Het
Dnah7c C T 1: 46,533,208 T947M probably damaging Het
Dsp A T 13: 38,179,073 Y443F probably damaging Het
Espl1 T A 15: 102,319,524 C1603* probably null Het
Faiml G T 9: 99,234,443 R65S probably benign Het
Gfpt2 T C 11: 49,804,955 I4T probably damaging Het
Gm10376 T A 14: 43,010,493 M179L probably benign Het
Gm13084 A T 4: 143,810,663 L366Q probably damaging Het
Gm4302 T A 10: 100,341,727 M291K unknown Het
Gm8906 C T 5: 11,505,231 P83S probably damaging Het
Gnb1l T A 16: 18,545,168 D154E probably benign Het
Igkv10-94 T C 6: 68,704,743 R38G possibly damaging Het
Inmt A T 6: 55,171,028 Y205* probably null Het
Krba1 A G 6: 48,416,299 Q1049R probably benign Het
Lpxn T A 19: 12,833,319 C376S probably damaging Het
Lrrc52 T A 1: 167,466,450 I89F probably damaging Het
Map9 A T 3: 82,363,458 T110S probably benign Het
Mccc1 T C 3: 35,995,818 Y75C probably damaging Het
Mff T A 1: 82,747,091 L203* probably null Het
Micall1 C A 15: 79,109,424 D47E unknown Het
Mink1 T C 11: 70,603,503 F243S probably damaging Het
Mlycd C T 8: 119,402,477 R228W probably damaging Het
Msr1 A T 8: 39,589,424 V370E possibly damaging Het
Naip6 T C 13: 100,300,419 E532G probably damaging Het
Nepn G A 10: 52,391,719 C27Y probably damaging Het
Ninl T C 2: 150,955,604 H592R probably benign Het
Nr4a2 A G 2: 57,112,249 M64T possibly damaging Het
Olfr1279 T A 2: 111,307,020 F272I probably benign Het
Olfr484 T C 7: 108,124,574 K230E probably damaging Het
Pcbp1 A T 6: 86,525,506 M137K possibly damaging Het
Pcf11 A T 7: 92,657,316 S1215T probably benign Het
Pecam1 T C 11: 106,689,031 I402V probably damaging Het
Pex12 T C 11: 83,297,642 T176A probably benign Het
Phf3 T C 1: 30,831,109 K286R possibly damaging Het
Pik3ap1 T A 19: 41,332,321 D153V probably damaging Het
Pkhd1l1 T A 15: 44,584,978 probably null Het
Plekhn1 A G 4: 156,223,335 V378A probably benign Het
Ptprm A T 17: 66,944,288 D531E possibly damaging Het
Pum2 A T 12: 8,728,952 Q508L possibly damaging Het
Rad54l A G 4: 116,105,830 S324P probably damaging Het
Reln A T 5: 21,976,596 V1763D possibly damaging Het
Rp1 T C 1: 4,348,168 N907S possibly damaging Het
Scaf11 T A 15: 96,420,328 N452Y possibly damaging Het
Scgb2b3 T A 7: 31,360,214 H45L possibly damaging Het
Sim1 A G 10: 50,895,927 T11A probably damaging Het
Slc5a12 T A 2: 110,616,714 M189K possibly damaging Het
Slco2b1 C T 7: 99,695,063 G10S probably null Het
Stxbp3 A G 3: 108,800,755 L410P probably damaging Het
Sugct T C 13: 17,302,009 N297D probably benign Het
Syne1 A G 10: 5,233,409 I4132T probably benign Het
Teddm1b A T 1: 153,875,166 L240F probably damaging Het
Tlr5 C A 1: 182,975,523 D797E possibly damaging Het
Tmprss13 G T 9: 45,338,345 G327C probably damaging Het
Tnrc18 G T 5: 142,787,817 A419D Het
Ttc28 T C 5: 111,280,007 Y1790H probably damaging Het
Vmn1r125 T G 7: 21,272,402 M75R probably damaging Het
Vwa3a T A 7: 120,773,030 D276E possibly damaging Het
Wdfy3 C T 5: 101,915,437 V1322M probably damaging Het
Wdr11 T C 7: 129,628,106 S872P possibly damaging Het
Zc3h13 T C 14: 75,321,721 S357P unknown Het
Other mutations in Cspp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Cspp1 APN 1 10112551 unclassified probably benign
IGL01070:Cspp1 APN 1 10088145 missense probably damaging 0.99
IGL01384:Cspp1 APN 1 10116680 missense probably damaging 1.00
IGL01400:Cspp1 APN 1 10085931 missense probably damaging 0.99
IGL01893:Cspp1 APN 1 10134141 unclassified probably null
IGL01909:Cspp1 APN 1 10066661 missense probably benign 0.01
IGL02229:Cspp1 APN 1 10083556 missense probably damaging 1.00
IGL02397:Cspp1 APN 1 10108465 missense possibly damaging 0.66
IGL02983:Cspp1 APN 1 10127525 missense probably benign 0.34
IGL03352:Cspp1 APN 1 10047437 missense possibly damaging 0.93
PIT4453001:Cspp1 UTSW 1 10074872 missense possibly damaging 0.83
R0312:Cspp1 UTSW 1 10058829 splice site probably benign
R0782:Cspp1 UTSW 1 10129974 splice site probably benign
R0931:Cspp1 UTSW 1 10104286 missense probably damaging 0.98
R1499:Cspp1 UTSW 1 10088966 splice site probably null
R1553:Cspp1 UTSW 1 10085897 missense possibly damaging 0.94
R1613:Cspp1 UTSW 1 10133241 missense probably damaging 1.00
R1644:Cspp1 UTSW 1 10126438 missense probably damaging 0.99
R2042:Cspp1 UTSW 1 10112538 missense probably damaging 0.98
R2090:Cspp1 UTSW 1 10090268 missense possibly damaging 0.89
R2178:Cspp1 UTSW 1 10104246 missense possibly damaging 0.81
R2247:Cspp1 UTSW 1 10066460 missense possibly damaging 0.87
R2680:Cspp1 UTSW 1 10104305 missense probably damaging 1.00
R3803:Cspp1 UTSW 1 10126373 missense probably damaging 1.00
R4520:Cspp1 UTSW 1 10134227 missense probably benign 0.11
R4531:Cspp1 UTSW 1 10066847 intron probably benign
R4906:Cspp1 UTSW 1 10082328 missense possibly damaging 0.82
R4960:Cspp1 UTSW 1 10126463 missense probably damaging 1.00
R4973:Cspp1 UTSW 1 10126463 missense probably damaging 1.00
R4976:Cspp1 UTSW 1 10126463 missense probably damaging 1.00
R4978:Cspp1 UTSW 1 10083517 missense possibly damaging 0.66
R4979:Cspp1 UTSW 1 10126463 missense probably damaging 1.00
R4981:Cspp1 UTSW 1 10126463 missense probably damaging 1.00
R4983:Cspp1 UTSW 1 10126463 missense probably damaging 1.00
R5032:Cspp1 UTSW 1 10066519 missense probably benign 0.07
R5057:Cspp1 UTSW 1 10074961 splice site probably benign
R5081:Cspp1 UTSW 1 10047466 missense possibly damaging 0.57
R5119:Cspp1 UTSW 1 10126463 missense probably damaging 1.00
R5121:Cspp1 UTSW 1 10126463 missense probably damaging 1.00
R5146:Cspp1 UTSW 1 10074876 nonsense probably null
R5373:Cspp1 UTSW 1 10134126 missense probably damaging 1.00
R5374:Cspp1 UTSW 1 10134126 missense probably damaging 1.00
R6230:Cspp1 UTSW 1 10077197 missense probably benign 0.01
R6291:Cspp1 UTSW 1 10064334 missense probably damaging 0.97
R6382:Cspp1 UTSW 1 10083475 intron probably null
Z1088:Cspp1 UTSW 1 10083546 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TTTTGCTGACTCTTAGCCTGGAAG -3'
(R):5'- TCACAAGAGAAATGGAGCTGTCC -3'

Sequencing Primer
(F):5'- ACTCTTAGCCTGGAAGGATGTATTG -3'
(R):5'- CTGAACTCACAGGATAGAGTTCTC -3'
Posted On2019-05-15