Incidental Mutation 'R7135:Lrrc52'
ID552971
Institutional Source Beutler Lab
Gene Symbol Lrrc52
Ensembl Gene ENSMUSG00000040485
Gene Nameleucine rich repeat containing 52
Synonyms4930413P14Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R7135 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location167445669-167466780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 167466450 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 89 (I89F)
Ref Sequence ENSEMBL: ENSMUSP00000047213 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036643]
Predicted Effect probably damaging
Transcript: ENSMUST00000036643
AA Change: I89F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047213
Gene: ENSMUSG00000040485
AA Change: I89F

DomainStartEndE-ValueType
LRRNT 25 57 4.21e-3 SMART
LRR 56 73 2.03e2 SMART
LRR 76 99 3.09e1 SMART
LRR 100 123 1.37e1 SMART
LRR 124 148 5.89e1 SMART
LRR 149 172 1.06e2 SMART
Blast:LRRCT 184 237 3e-26 BLAST
transmembrane domain 246 268 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Male mice homozygous for a null allele display reduced fertility with impaired fertilization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016G14Rik T C 13: 24,741,506 S78P probably benign Het
Aars2 T A 17: 45,508,961 Y221* probably null Het
Ankmy2 T C 12: 36,196,312 S412P probably benign Het
Ap1s3 T C 1: 79,609,202 T144A probably benign Het
Asb3 T A 11: 30,998,501 L59* probably null Het
Asxl3 G T 18: 22,517,701 G916* probably null Het
Asxl3 G C 18: 22,517,702 G916A probably damaging Het
Birc2 A C 9: 7,818,761 F610V probably damaging Het
Camk4 G A 18: 33,107,943 probably null Het
Ccdc162 A G 10: 41,673,859 S343P probably benign Het
Ccnk T A 12: 108,186,475 L17Q probably damaging Het
Cd59b G A 2: 104,084,447 W63* probably null Het
Chrm3 C T 13: 9,877,801 V400I probably benign Het
Crb1 C A 1: 139,243,367 V762F probably damaging Het
Cspp1 C T 1: 10,088,936 T529I possibly damaging Het
Cttnbp2 A G 6: 18,448,447 I71T possibly damaging Het
Cyb561 C A 11: 105,935,567 G90V probably damaging Het
Cyld T A 8: 88,744,892 D804E possibly damaging Het
Ddx31 G A 2: 28,848,306 V160I probably benign Het
Dgkg T C 16: 22,500,382 D643G probably damaging Het
Dnah12 G A 14: 26,778,912 probably null Het
Dnah12 T G 14: 26,801,413 I1953S probably damaging Het
Dnah7b T C 1: 46,139,710 W848R probably damaging Het
Dnah7c C T 1: 46,533,208 T947M probably damaging Het
Dsp A T 13: 38,179,073 Y443F probably damaging Het
Espl1 T A 15: 102,319,524 C1603* probably null Het
Faiml G T 9: 99,234,443 R65S probably benign Het
Gfpt2 T C 11: 49,804,955 I4T probably damaging Het
Gm10376 T A 14: 43,010,493 M179L probably benign Het
Gm13084 A T 4: 143,810,663 L366Q probably damaging Het
Gm4302 T A 10: 100,341,727 M291K unknown Het
Gm8906 C T 5: 11,505,231 P83S probably damaging Het
Gnb1l T A 16: 18,545,168 D154E probably benign Het
Igkv10-94 T C 6: 68,704,743 R38G possibly damaging Het
Inmt A T 6: 55,171,028 Y205* probably null Het
Krba1 A G 6: 48,416,299 Q1049R probably benign Het
Lpxn T A 19: 12,833,319 C376S probably damaging Het
Map9 A T 3: 82,363,458 T110S probably benign Het
Mccc1 T C 3: 35,995,818 Y75C probably damaging Het
Mff T A 1: 82,747,091 L203* probably null Het
Micall1 C A 15: 79,109,424 D47E unknown Het
Mink1 T C 11: 70,603,503 F243S probably damaging Het
Mlycd C T 8: 119,402,477 R228W probably damaging Het
Msr1 A T 8: 39,589,424 V370E possibly damaging Het
Naip6 T C 13: 100,300,419 E532G probably damaging Het
Nepn G A 10: 52,391,719 C27Y probably damaging Het
Ninl T C 2: 150,955,604 H592R probably benign Het
Nr4a2 A G 2: 57,112,249 M64T possibly damaging Het
Olfr1279 T A 2: 111,307,020 F272I probably benign Het
Olfr484 T C 7: 108,124,574 K230E probably damaging Het
Pcbp1 A T 6: 86,525,506 M137K possibly damaging Het
Pcf11 A T 7: 92,657,316 S1215T probably benign Het
Pecam1 T C 11: 106,689,031 I402V probably damaging Het
Pex12 T C 11: 83,297,642 T176A probably benign Het
Phf3 T C 1: 30,831,109 K286R possibly damaging Het
Pik3ap1 T A 19: 41,332,321 D153V probably damaging Het
Pkhd1l1 T A 15: 44,584,978 probably null Het
Plekhn1 A G 4: 156,223,335 V378A probably benign Het
Ptprm A T 17: 66,944,288 D531E possibly damaging Het
Pum2 A T 12: 8,728,952 Q508L possibly damaging Het
Rad54l A G 4: 116,105,830 S324P probably damaging Het
Reln A T 5: 21,976,596 V1763D possibly damaging Het
Rp1 T C 1: 4,348,168 N907S possibly damaging Het
Scaf11 T A 15: 96,420,328 N452Y possibly damaging Het
Scgb2b3 T A 7: 31,360,214 H45L possibly damaging Het
Sim1 A G 10: 50,895,927 T11A probably damaging Het
Slc5a12 T A 2: 110,616,714 M189K possibly damaging Het
Slco2b1 C T 7: 99,695,063 G10S probably null Het
Stxbp3 A G 3: 108,800,755 L410P probably damaging Het
Sugct T C 13: 17,302,009 N297D probably benign Het
Syne1 A G 10: 5,233,409 I4132T probably benign Het
Teddm1b A T 1: 153,875,166 L240F probably damaging Het
Tlr5 C A 1: 182,975,523 D797E possibly damaging Het
Tmprss13 G T 9: 45,338,345 G327C probably damaging Het
Tnrc18 G T 5: 142,787,817 A419D Het
Ttc28 T C 5: 111,280,007 Y1790H probably damaging Het
Vmn1r125 T G 7: 21,272,402 M75R probably damaging Het
Vwa3a T A 7: 120,773,030 D276E possibly damaging Het
Wdfy3 C T 5: 101,915,437 V1322M probably damaging Het
Wdr11 T C 7: 129,628,106 S872P possibly damaging Het
Zc3h13 T C 14: 75,321,721 S357P unknown Het
Other mutations in Lrrc52
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02126:Lrrc52 APN 1 167446006 missense probably damaging 1.00
IGL02232:Lrrc52 APN 1 167466380 missense probably damaging 0.99
R2030:Lrrc52 UTSW 1 167466459 missense probably benign 0.07
R2252:Lrrc52 UTSW 1 167466368 missense probably damaging 1.00
R4695:Lrrc52 UTSW 1 167466091 critical splice donor site probably null
R6155:Lrrc52 UTSW 1 167466727 start gained probably benign
R6248:Lrrc52 UTSW 1 167466395 missense probably damaging 1.00
R6661:Lrrc52 UTSW 1 167466353 missense probably damaging 1.00
Z1088:Lrrc52 UTSW 1 167466494 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- GGTACCTCAAAGACGTGGTG -3'
(R):5'- TCAGGGTCCAAGTGTCCAAAC -3'

Sequencing Primer
(F):5'- CCTCAAAGACGTGGTGTTGGC -3'
(R):5'- TCCAAGTGTCCAAACAAGTGTGTG -3'
Posted On2019-05-15