Incidental Mutation 'R7135:Olfr1279'
ID552977
Institutional Source Beutler Lab
Gene Symbol Olfr1279
Ensembl Gene ENSMUSG00000109813
Gene Nameolfactory receptor 1279
SynonymsMOR245-12, GA_x6K02T2Q125-72357646-72358581
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R7135 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location111300635-111309043 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 111307020 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 272 (F272I)
Ref Sequence ENSEMBL: ENSMUSP00000149972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090329] [ENSMUST00000213823] [ENSMUST00000216697]
Predicted Effect probably benign
Transcript: ENSMUST00000090329
AA Change: F274I

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000087801
Gene: ENSMUSG00000109813
AA Change: F274I

DomainStartEndE-ValueType
Pfam:7tm_4 33 306 1.7e-44 PFAM
Pfam:7TM_GPCR_Srsx 36 300 3.2e-5 PFAM
Pfam:7tm_1 43 289 7.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213823
AA Change: F272I

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000216697
AA Change: F272I

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016G14Rik T C 13: 24,741,506 S78P probably benign Het
Aars2 T A 17: 45,508,961 Y221* probably null Het
Ankmy2 T C 12: 36,196,312 S412P probably benign Het
Ap1s3 T C 1: 79,609,202 T144A probably benign Het
Asb3 T A 11: 30,998,501 L59* probably null Het
Asxl3 G T 18: 22,517,701 G916* probably null Het
Asxl3 G C 18: 22,517,702 G916A probably damaging Het
Birc2 A C 9: 7,818,761 F610V probably damaging Het
Camk4 G A 18: 33,107,943 probably null Het
Ccdc162 A G 10: 41,673,859 S343P probably benign Het
Ccnk T A 12: 108,186,475 L17Q probably damaging Het
Cd59b G A 2: 104,084,447 W63* probably null Het
Chrm3 C T 13: 9,877,801 V400I probably benign Het
Crb1 C A 1: 139,243,367 V762F probably damaging Het
Cspp1 C T 1: 10,088,936 T529I possibly damaging Het
Cttnbp2 A G 6: 18,448,447 I71T possibly damaging Het
Cyb561 C A 11: 105,935,567 G90V probably damaging Het
Cyld T A 8: 88,744,892 D804E possibly damaging Het
Ddx31 G A 2: 28,848,306 V160I probably benign Het
Dgkg T C 16: 22,500,382 D643G probably damaging Het
Dnah12 G A 14: 26,778,912 probably null Het
Dnah12 T G 14: 26,801,413 I1953S probably damaging Het
Dnah7b T C 1: 46,139,710 W848R probably damaging Het
Dnah7c C T 1: 46,533,208 T947M probably damaging Het
Dsp A T 13: 38,179,073 Y443F probably damaging Het
Espl1 T A 15: 102,319,524 C1603* probably null Het
Faiml G T 9: 99,234,443 R65S probably benign Het
Gfpt2 T C 11: 49,804,955 I4T probably damaging Het
Gm10376 T A 14: 43,010,493 M179L probably benign Het
Gm13084 A T 4: 143,810,663 L366Q probably damaging Het
Gm4302 T A 10: 100,341,727 M291K unknown Het
Gm8906 C T 5: 11,505,231 P83S probably damaging Het
Gnb1l T A 16: 18,545,168 D154E probably benign Het
Igkv10-94 T C 6: 68,704,743 R38G possibly damaging Het
Inmt A T 6: 55,171,028 Y205* probably null Het
Krba1 A G 6: 48,416,299 Q1049R probably benign Het
Lpxn T A 19: 12,833,319 C376S probably damaging Het
Lrrc52 T A 1: 167,466,450 I89F probably damaging Het
Map9 A T 3: 82,363,458 T110S probably benign Het
Mccc1 T C 3: 35,995,818 Y75C probably damaging Het
Mff T A 1: 82,747,091 L203* probably null Het
Micall1 C A 15: 79,109,424 D47E unknown Het
Mink1 T C 11: 70,603,503 F243S probably damaging Het
Mlycd C T 8: 119,402,477 R228W probably damaging Het
Msr1 A T 8: 39,589,424 V370E possibly damaging Het
Naip6 T C 13: 100,300,419 E532G probably damaging Het
Nepn G A 10: 52,391,719 C27Y probably damaging Het
Ninl T C 2: 150,955,604 H592R probably benign Het
Nr4a2 A G 2: 57,112,249 M64T possibly damaging Het
Olfr484 T C 7: 108,124,574 K230E probably damaging Het
Pcbp1 A T 6: 86,525,506 M137K possibly damaging Het
Pcf11 A T 7: 92,657,316 S1215T probably benign Het
Pecam1 T C 11: 106,689,031 I402V probably damaging Het
Pex12 T C 11: 83,297,642 T176A probably benign Het
Phf3 T C 1: 30,831,109 K286R possibly damaging Het
Pik3ap1 T A 19: 41,332,321 D153V probably damaging Het
Pkhd1l1 T A 15: 44,584,978 probably null Het
Plekhn1 A G 4: 156,223,335 V378A probably benign Het
Ptprm A T 17: 66,944,288 D531E possibly damaging Het
Pum2 A T 12: 8,728,952 Q508L possibly damaging Het
Rad54l A G 4: 116,105,830 S324P probably damaging Het
Reln A T 5: 21,976,596 V1763D possibly damaging Het
Rp1 T C 1: 4,348,168 N907S possibly damaging Het
Scaf11 T A 15: 96,420,328 N452Y possibly damaging Het
Scgb2b3 T A 7: 31,360,214 H45L possibly damaging Het
Sim1 A G 10: 50,895,927 T11A probably damaging Het
Slc5a12 T A 2: 110,616,714 M189K possibly damaging Het
Slco2b1 C T 7: 99,695,063 G10S probably null Het
Stxbp3 A G 3: 108,800,755 L410P probably damaging Het
Sugct T C 13: 17,302,009 N297D probably benign Het
Syne1 A G 10: 5,233,409 I4132T probably benign Het
Teddm1b A T 1: 153,875,166 L240F probably damaging Het
Tlr5 C A 1: 182,975,523 D797E possibly damaging Het
Tmprss13 G T 9: 45,338,345 G327C probably damaging Het
Tnrc18 G T 5: 142,787,817 A419D Het
Ttc28 T C 5: 111,280,007 Y1790H probably damaging Het
Vmn1r125 T G 7: 21,272,402 M75R probably damaging Het
Vwa3a T A 7: 120,773,030 D276E possibly damaging Het
Wdfy3 C T 5: 101,915,437 V1322M probably damaging Het
Wdr11 T C 7: 129,628,106 S872P possibly damaging Het
Zc3h13 T C 14: 75,321,721 S357P unknown Het
Other mutations in Olfr1279
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Olfr1279 APN 2 111306621 missense probably benign 0.19
IGL01355:Olfr1279 APN 2 111307093 missense probably benign 0.00
IGL01864:Olfr1279 APN 2 111307055 missense probably damaging 1.00
IGL02160:Olfr1279 APN 2 111306798 missense probably benign 0.02
IGL02183:Olfr1279 APN 2 111306418 missense probably damaging 0.98
PIT4377001:Olfr1279 UTSW 2 111306880 missense probably damaging 1.00
R0280:Olfr1279 UTSW 2 111307072 missense possibly damaging 0.48
R0636:Olfr1279 UTSW 2 111306412 missense probably benign 0.06
R0732:Olfr1279 UTSW 2 111306980 nonsense probably null
R1661:Olfr1279 UTSW 2 111306771 missense probably damaging 1.00
R1665:Olfr1279 UTSW 2 111306771 missense probably damaging 1.00
R2251:Olfr1279 UTSW 2 111306310 missense probably damaging 1.00
R2252:Olfr1279 UTSW 2 111306310 missense probably damaging 1.00
R2253:Olfr1279 UTSW 2 111306310 missense probably damaging 1.00
R2473:Olfr1279 UTSW 2 111306891 missense probably damaging 1.00
R3408:Olfr1279 UTSW 2 111306505 missense probably damaging 1.00
R5020:Olfr1279 UTSW 2 111306292 missense probably benign 0.01
R5634:Olfr1279 UTSW 2 111307092 missense probably benign
R5647:Olfr1279 UTSW 2 111307047 missense possibly damaging 0.67
R6782:Olfr1279 UTSW 2 111306745 missense probably damaging 1.00
R6911:Olfr1279 UTSW 2 111306273 missense probably benign 0.00
R7167:Olfr1279 UTSW 2 111306448 missense probably benign 0.10
X0021:Olfr1279 UTSW 2 111306588 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACAACTGGCGTGCACTGATG -3'
(R):5'- TGTGTCTCAGTGGAACCTTC -3'

Sequencing Primer
(F):5'- TGGCGTGCACTGATGGAGAC -3'
(R):5'- TGTCTCAGTGGAACCTTCTAATATAC -3'
Posted On2019-05-15