Incidental Mutation 'R7135:Cttnbp2'
ID552990
Institutional Source Beutler Lab
Gene Symbol Cttnbp2
Ensembl Gene ENSMUSG00000000416
Gene Namecortactin binding protein 2
Synonyms4732477G22Rik, 3010022N24Rik, Cortbp2, ORF4, 9130022E09Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.279) question?
Stock #R7135 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location18366478-18514843 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18448447 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 71 (I71T)
Ref Sequence ENSEMBL: ENSMUSP00000088089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090601] [ENSMUST00000129669] [ENSMUST00000142963] [ENSMUST00000148602]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090601
AA Change: I71T

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000088089
Gene: ENSMUSG00000000416
AA Change: I71T

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
Pfam:CortBP2 32 138 3.1e-34 PFAM
low complexity region 197 213 N/A INTRINSIC
low complexity region 255 270 N/A INTRINSIC
low complexity region 393 415 N/A INTRINSIC
low complexity region 539 547 N/A INTRINSIC
low complexity region 594 606 N/A INTRINSIC
low complexity region 662 673 N/A INTRINSIC
ANK 699 729 5.21e1 SMART
ANK 733 762 7.02e-5 SMART
ANK 766 795 6.55e-5 SMART
ANK 799 828 4.1e-6 SMART
ANK 832 861 1.09e-1 SMART
ANK 901 931 4.43e-2 SMART
Blast:AAA 1108 1285 1e-18 BLAST
low complexity region 1609 1623 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000129669
AA Change: I29T

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000116878
Gene: ENSMUSG00000000416
AA Change: I29T

DomainStartEndE-ValueType
Pfam:CortBP2 1 100 4.6e-44 PFAM
Pfam:CortBP2 92 138 3.2e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000142963
AA Change: I29T

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000122590
Gene: ENSMUSG00000000416
AA Change: I29T

DomainStartEndE-ValueType
Pfam:CortBP2 1 94 1.8e-43 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000148602
AA Change: I71T

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000118432
Gene: ENSMUSG00000000416
AA Change: I71T

DomainStartEndE-ValueType
Pfam:CortBP2 26 138 4.3e-50 PFAM
Pfam:CortBP2 134 180 1.3e-12 PFAM
low complexity region 197 213 N/A INTRINSIC
low complexity region 255 270 N/A INTRINSIC
low complexity region 393 415 N/A INTRINSIC
low complexity region 539 547 N/A INTRINSIC
low complexity region 594 606 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with six ankyrin repeats and several proline-rich regions. A similar gene in rat interacts with a central regulator of the actin cytoskeleton. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016G14Rik T C 13: 24,741,506 S78P probably benign Het
Aars2 T A 17: 45,508,961 Y221* probably null Het
Ankmy2 T C 12: 36,196,312 S412P probably benign Het
Ap1s3 T C 1: 79,609,202 T144A probably benign Het
Asb3 T A 11: 30,998,501 L59* probably null Het
Asxl3 G T 18: 22,517,701 G916* probably null Het
Asxl3 G C 18: 22,517,702 G916A probably damaging Het
Birc2 A C 9: 7,818,761 F610V probably damaging Het
Camk4 G A 18: 33,107,943 probably null Het
Ccdc162 A G 10: 41,673,859 S343P probably benign Het
Ccnk T A 12: 108,186,475 L17Q probably damaging Het
Cd59b G A 2: 104,084,447 W63* probably null Het
Chrm3 C T 13: 9,877,801 V400I probably benign Het
Crb1 C A 1: 139,243,367 V762F probably damaging Het
Cspp1 C T 1: 10,088,936 T529I possibly damaging Het
Cyb561 C A 11: 105,935,567 G90V probably damaging Het
Cyld T A 8: 88,744,892 D804E possibly damaging Het
Ddx31 G A 2: 28,848,306 V160I probably benign Het
Dgkg T C 16: 22,500,382 D643G probably damaging Het
Dnah12 G A 14: 26,778,912 probably null Het
Dnah12 T G 14: 26,801,413 I1953S probably damaging Het
Dnah7b T C 1: 46,139,710 W848R probably damaging Het
Dnah7c C T 1: 46,533,208 T947M probably damaging Het
Dsp A T 13: 38,179,073 Y443F probably damaging Het
Espl1 T A 15: 102,319,524 C1603* probably null Het
Faiml G T 9: 99,234,443 R65S probably benign Het
Gfpt2 T C 11: 49,804,955 I4T probably damaging Het
Gm10376 T A 14: 43,010,493 M179L probably benign Het
Gm13084 A T 4: 143,810,663 L366Q probably damaging Het
Gm4302 T A 10: 100,341,727 M291K unknown Het
Gm8906 C T 5: 11,505,231 P83S probably damaging Het
Gnb1l T A 16: 18,545,168 D154E probably benign Het
Igkv10-94 T C 6: 68,704,743 R38G possibly damaging Het
Inmt A T 6: 55,171,028 Y205* probably null Het
Krba1 A G 6: 48,416,299 Q1049R probably benign Het
Lpxn T A 19: 12,833,319 C376S probably damaging Het
Lrrc52 T A 1: 167,466,450 I89F probably damaging Het
Map9 A T 3: 82,363,458 T110S probably benign Het
Mccc1 T C 3: 35,995,818 Y75C probably damaging Het
Mff T A 1: 82,747,091 L203* probably null Het
Micall1 C A 15: 79,109,424 D47E unknown Het
Mink1 T C 11: 70,603,503 F243S probably damaging Het
Mlycd C T 8: 119,402,477 R228W probably damaging Het
Msr1 A T 8: 39,589,424 V370E possibly damaging Het
Naip6 T C 13: 100,300,419 E532G probably damaging Het
Nepn G A 10: 52,391,719 C27Y probably damaging Het
Ninl T C 2: 150,955,604 H592R probably benign Het
Nr4a2 A G 2: 57,112,249 M64T possibly damaging Het
Olfr1279 T A 2: 111,307,020 F272I probably benign Het
Olfr484 T C 7: 108,124,574 K230E probably damaging Het
Pcbp1 A T 6: 86,525,506 M137K possibly damaging Het
Pcf11 A T 7: 92,657,316 S1215T probably benign Het
Pecam1 T C 11: 106,689,031 I402V probably damaging Het
Pex12 T C 11: 83,297,642 T176A probably benign Het
Phf3 T C 1: 30,831,109 K286R possibly damaging Het
Pik3ap1 T A 19: 41,332,321 D153V probably damaging Het
Pkhd1l1 T A 15: 44,584,978 probably null Het
Plekhn1 A G 4: 156,223,335 V378A probably benign Het
Ptprm A T 17: 66,944,288 D531E possibly damaging Het
Pum2 A T 12: 8,728,952 Q508L possibly damaging Het
Rad54l A G 4: 116,105,830 S324P probably damaging Het
Reln A T 5: 21,976,596 V1763D possibly damaging Het
Rp1 T C 1: 4,348,168 N907S possibly damaging Het
Scaf11 T A 15: 96,420,328 N452Y possibly damaging Het
Scgb2b3 T A 7: 31,360,214 H45L possibly damaging Het
Sim1 A G 10: 50,895,927 T11A probably damaging Het
Slc5a12 T A 2: 110,616,714 M189K possibly damaging Het
Slco2b1 C T 7: 99,695,063 G10S probably null Het
Stxbp3 A G 3: 108,800,755 L410P probably damaging Het
Sugct T C 13: 17,302,009 N297D probably benign Het
Syne1 A G 10: 5,233,409 I4132T probably benign Het
Teddm1b A T 1: 153,875,166 L240F probably damaging Het
Tlr5 C A 1: 182,975,523 D797E possibly damaging Het
Tmprss13 G T 9: 45,338,345 G327C probably damaging Het
Tnrc18 G T 5: 142,787,817 A419D Het
Ttc28 T C 5: 111,280,007 Y1790H probably damaging Het
Vmn1r125 T G 7: 21,272,402 M75R probably damaging Het
Vwa3a T A 7: 120,773,030 D276E possibly damaging Het
Wdfy3 C T 5: 101,915,437 V1322M probably damaging Het
Wdr11 T C 7: 129,628,106 S872P possibly damaging Het
Zc3h13 T C 14: 75,321,721 S357P unknown Het
Other mutations in Cttnbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Cttnbp2 APN 6 18381062 missense possibly damaging 0.71
IGL01014:Cttnbp2 APN 6 18423895 missense probably damaging 0.98
IGL01148:Cttnbp2 APN 6 18382818 missense probably damaging 1.00
IGL01903:Cttnbp2 APN 6 18501965 missense probably damaging 1.00
IGL01906:Cttnbp2 APN 6 18378376 nonsense probably null
IGL01994:Cttnbp2 APN 6 18420815 missense possibly damaging 0.77
IGL02212:Cttnbp2 APN 6 18382749 missense possibly damaging 0.78
IGL02696:Cttnbp2 APN 6 18434129 missense probably benign 0.01
IGL02813:Cttnbp2 APN 6 18367538 missense possibly damaging 0.94
IGL02864:Cttnbp2 APN 6 18374549 missense probably benign 0.21
IGL03309:Cttnbp2 APN 6 18381036 missense probably damaging 0.98
FR4304:Cttnbp2 UTSW 6 18367458 utr 3 prime probably benign
FR4449:Cttnbp2 UTSW 6 18367462 utr 3 prime probably benign
FR4548:Cttnbp2 UTSW 6 18367463 utr 3 prime probably benign
FR4589:Cttnbp2 UTSW 6 18367458 utr 3 prime probably benign
FR4976:Cttnbp2 UTSW 6 18367461 utr 3 prime probably benign
FR4976:Cttnbp2 UTSW 6 18367467 utr 3 prime probably benign
R0165:Cttnbp2 UTSW 6 18435410 nonsense probably null
R0382:Cttnbp2 UTSW 6 18435343 missense probably benign 0.39
R0464:Cttnbp2 UTSW 6 18408691 missense possibly damaging 0.81
R0550:Cttnbp2 UTSW 6 18435309 missense possibly damaging 0.89
R0571:Cttnbp2 UTSW 6 18381103 missense probably benign
R0627:Cttnbp2 UTSW 6 18367373 makesense probably null
R0788:Cttnbp2 UTSW 6 18423835 missense probably damaging 1.00
R0826:Cttnbp2 UTSW 6 18405178 splice site probably benign
R1319:Cttnbp2 UTSW 6 18434630 missense probably benign 0.00
R1476:Cttnbp2 UTSW 6 18434221 missense probably damaging 1.00
R1572:Cttnbp2 UTSW 6 18375975 missense possibly damaging 0.68
R1596:Cttnbp2 UTSW 6 18408592 missense probably damaging 1.00
R1607:Cttnbp2 UTSW 6 18435433 missense probably damaging 1.00
R1633:Cttnbp2 UTSW 6 18435167 missense probably damaging 1.00
R1634:Cttnbp2 UTSW 6 18408657 missense probably benign 0.39
R1661:Cttnbp2 UTSW 6 18434983 missense probably benign 0.20
R1665:Cttnbp2 UTSW 6 18434983 missense probably benign 0.20
R1834:Cttnbp2 UTSW 6 18501966 missense probably damaging 1.00
R1853:Cttnbp2 UTSW 6 18408602 missense probably benign 0.00
R1855:Cttnbp2 UTSW 6 18378413 missense probably benign
R2018:Cttnbp2 UTSW 6 18434518 missense probably damaging 1.00
R2169:Cttnbp2 UTSW 6 18426097 missense probably benign 0.00
R2175:Cttnbp2 UTSW 6 18434829 unclassified probably null
R2202:Cttnbp2 UTSW 6 18408694 missense probably benign 0.12
R2203:Cttnbp2 UTSW 6 18408694 missense probably benign 0.12
R2204:Cttnbp2 UTSW 6 18408694 missense probably benign 0.12
R2205:Cttnbp2 UTSW 6 18408694 missense probably benign 0.12
R2371:Cttnbp2 UTSW 6 18380604 missense possibly damaging 0.69
R2416:Cttnbp2 UTSW 6 18448286 missense probably damaging 0.99
R3414:Cttnbp2 UTSW 6 18389205 missense probably benign
R3617:Cttnbp2 UTSW 6 18414190 missense probably damaging 1.00
R3861:Cttnbp2 UTSW 6 18423833 missense probably benign 0.11
R3862:Cttnbp2 UTSW 6 18434906 missense probably benign 0.02
R3940:Cttnbp2 UTSW 6 18420975 missense probably benign 0.34
R3941:Cttnbp2 UTSW 6 18427453 missense probably benign 0.11
R4097:Cttnbp2 UTSW 6 18420872 missense probably benign
R4211:Cttnbp2 UTSW 6 18427543 missense probably damaging 1.00
R4353:Cttnbp2 UTSW 6 18514704 missense probably benign 0.00
R4367:Cttnbp2 UTSW 6 18405249 missense probably damaging 1.00
R4651:Cttnbp2 UTSW 6 18434038 missense possibly damaging 0.81
R4652:Cttnbp2 UTSW 6 18434038 missense possibly damaging 0.81
R4660:Cttnbp2 UTSW 6 18406537 missense probably benign 0.05
R4975:Cttnbp2 UTSW 6 18406526 missense possibly damaging 0.91
R5064:Cttnbp2 UTSW 6 18448279 missense probably damaging 1.00
R5205:Cttnbp2 UTSW 6 18427433 splice site probably benign
R5305:Cttnbp2 UTSW 6 18381098 missense probably benign
R5484:Cttnbp2 UTSW 6 18427690 intron probably benign
R5629:Cttnbp2 UTSW 6 18405218 missense probably damaging 1.00
R5763:Cttnbp2 UTSW 6 18414299 missense probably benign 0.00
R5766:Cttnbp2 UTSW 6 18381033 missense possibly damaging 0.87
R5942:Cttnbp2 UTSW 6 18448440 missense probably damaging 1.00
R6073:Cttnbp2 UTSW 6 18434233 missense probably damaging 1.00
R6073:Cttnbp2 UTSW 6 18448369 missense probably benign 0.01
R6163:Cttnbp2 UTSW 6 18434951 missense possibly damaging 0.91
R6545:Cttnbp2 UTSW 6 18405279 intron probably null
R6858:Cttnbp2 UTSW 6 18448453 missense probably damaging 1.00
R7037:Cttnbp2 UTSW 6 18435118 missense probably damaging 1.00
R7141:Cttnbp2 UTSW 6 18380468 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACAGATGACGTCTCAGTACC -3'
(R):5'- CTTTCCAGGCTTGTCAGGAC -3'

Sequencing Primer
(F):5'- CTCTCAGCGGCCACCAG -3'
(R):5'- CTTGTCAGGACTGGGGCTC -3'
Posted On2019-05-15