Incidental Mutation 'R7135:Birc2'
ID553005
Institutional Source Beutler Lab
Gene Symbol Birc2
Ensembl Gene ENSMUSG00000057367
Gene Namebaculoviral IAP repeat-containing 2
SynonymscIAP-1, Api1, HIAP1, IAP1, MIAP1, mcIAP1, MIHB, cIAP1
Accession Numbers

Genbank: NM_007465.2; Ensembl: ENSMUST00000074246

Is this an essential gene? Probably essential (E-score: 0.810) question?
Stock #R7135 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location7818227-7837064 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 7818761 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 610 (F610V)
Ref Sequence ENSEMBL: ENSMUSP00000091422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074246] [ENSMUST00000190341]
Predicted Effect probably damaging
Transcript: ENSMUST00000074246
AA Change: F610V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091422
Gene: ENSMUSG00000057367
AA Change: F610V

DomainStartEndE-ValueType
BIR 44 115 4.06e-33 SMART
BIR 175 245 4.25e-36 SMART
BIR 260 331 2.24e-35 SMART
low complexity region 432 446 N/A INTRINSIC
CARD 447 535 1.64e-20 SMART
low complexity region 552 563 N/A INTRINSIC
RING 565 599 1.65e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000190341
AA Change: F610V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140049
Gene: ENSMUSG00000057367
AA Change: F610V

DomainStartEndE-ValueType
BIR 44 115 4.06e-33 SMART
BIR 175 245 4.25e-36 SMART
BIR 260 331 2.24e-35 SMART
low complexity region 432 446 N/A INTRINSIC
CARD 447 535 1.64e-20 SMART
low complexity region 552 563 N/A INTRINSIC
RING 565 599 1.65e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of proteins that inhibits apoptosis by binding to tumor necrosis factor receptor-associated factors TRAF1 and TRAF2, probably by interfering with activation of ICE-like proteases. This encoded protein inhibits apoptosis induced by serum deprivation and menadione, a potent inducer of free radicals. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous null mice showed a modest reduction in the number of lymphocytes. Mice homozygous for a knock-in allele exhibit increased T cell poliferation and IFNG secretion in response to anti-CD3 stimulation. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Gene trapped(2)

Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016G14Rik T C 13: 24,741,506 S78P probably benign Het
Aars2 T A 17: 45,508,961 Y221* probably null Het
Ankmy2 T C 12: 36,196,312 S412P probably benign Het
Ap1s3 T C 1: 79,609,202 T144A probably benign Het
Asb3 T A 11: 30,998,501 L59* probably null Het
Asxl3 G T 18: 22,517,701 G916* probably null Het
Asxl3 G C 18: 22,517,702 G916A probably damaging Het
Camk4 G A 18: 33,107,943 probably null Het
Ccdc162 A G 10: 41,673,859 S343P probably benign Het
Ccnk T A 12: 108,186,475 L17Q probably damaging Het
Cd59b G A 2: 104,084,447 W63* probably null Het
Chrm3 C T 13: 9,877,801 V400I probably benign Het
Crb1 C A 1: 139,243,367 V762F probably damaging Het
Cspp1 C T 1: 10,088,936 T529I possibly damaging Het
Cttnbp2 A G 6: 18,448,447 I71T possibly damaging Het
Cyb561 C A 11: 105,935,567 G90V probably damaging Het
Cyld T A 8: 88,744,892 D804E possibly damaging Het
Ddx31 G A 2: 28,848,306 V160I probably benign Het
Dgkg T C 16: 22,500,382 D643G probably damaging Het
Dnah12 G A 14: 26,778,912 probably null Het
Dnah12 T G 14: 26,801,413 I1953S probably damaging Het
Dnah7b T C 1: 46,139,710 W848R probably damaging Het
Dnah7c C T 1: 46,533,208 T947M probably damaging Het
Dsp A T 13: 38,179,073 Y443F probably damaging Het
Espl1 T A 15: 102,319,524 C1603* probably null Het
Faiml G T 9: 99,234,443 R65S probably benign Het
Gfpt2 T C 11: 49,804,955 I4T probably damaging Het
Gm10376 T A 14: 43,010,493 M179L probably benign Het
Gm13084 A T 4: 143,810,663 L366Q probably damaging Het
Gm4302 T A 10: 100,341,727 M291K unknown Het
Gm8906 C T 5: 11,505,231 P83S probably damaging Het
Gnb1l T A 16: 18,545,168 D154E probably benign Het
Igkv10-94 T C 6: 68,704,743 R38G possibly damaging Het
Inmt A T 6: 55,171,028 Y205* probably null Het
Krba1 A G 6: 48,416,299 Q1049R probably benign Het
Lpxn T A 19: 12,833,319 C376S probably damaging Het
Lrrc52 T A 1: 167,466,450 I89F probably damaging Het
Map9 A T 3: 82,363,458 T110S probably benign Het
Mccc1 T C 3: 35,995,818 Y75C probably damaging Het
Mff T A 1: 82,747,091 L203* probably null Het
Micall1 C A 15: 79,109,424 D47E unknown Het
Mink1 T C 11: 70,603,503 F243S probably damaging Het
Mlycd C T 8: 119,402,477 R228W probably damaging Het
Msr1 A T 8: 39,589,424 V370E possibly damaging Het
Naip6 T C 13: 100,300,419 E532G probably damaging Het
Nepn G A 10: 52,391,719 C27Y probably damaging Het
Ninl T C 2: 150,955,604 H592R probably benign Het
Nr4a2 A G 2: 57,112,249 M64T possibly damaging Het
Olfr1279 T A 2: 111,307,020 F272I probably benign Het
Olfr484 T C 7: 108,124,574 K230E probably damaging Het
Pcbp1 A T 6: 86,525,506 M137K possibly damaging Het
Pcf11 A T 7: 92,657,316 S1215T probably benign Het
Pecam1 T C 11: 106,689,031 I402V probably damaging Het
Pex12 T C 11: 83,297,642 T176A probably benign Het
Phf3 T C 1: 30,831,109 K286R possibly damaging Het
Pik3ap1 T A 19: 41,332,321 D153V probably damaging Het
Pkhd1l1 T A 15: 44,584,978 probably null Het
Plekhn1 A G 4: 156,223,335 V378A probably benign Het
Ptprm A T 17: 66,944,288 D531E possibly damaging Het
Pum2 A T 12: 8,728,952 Q508L possibly damaging Het
Rad54l A G 4: 116,105,830 S324P probably damaging Het
Reln A T 5: 21,976,596 V1763D possibly damaging Het
Rp1 T C 1: 4,348,168 N907S possibly damaging Het
Scaf11 T A 15: 96,420,328 N452Y possibly damaging Het
Scgb2b3 T A 7: 31,360,214 H45L possibly damaging Het
Sim1 A G 10: 50,895,927 T11A probably damaging Het
Slc5a12 T A 2: 110,616,714 M189K possibly damaging Het
Slco2b1 C T 7: 99,695,063 G10S probably null Het
Stxbp3 A G 3: 108,800,755 L410P probably damaging Het
Sugct T C 13: 17,302,009 N297D probably benign Het
Syne1 A G 10: 5,233,409 I4132T probably benign Het
Teddm1b A T 1: 153,875,166 L240F probably damaging Het
Tlr5 C A 1: 182,975,523 D797E possibly damaging Het
Tmprss13 G T 9: 45,338,345 G327C probably damaging Het
Tnrc18 G T 5: 142,787,817 A419D Het
Ttc28 T C 5: 111,280,007 Y1790H probably damaging Het
Vmn1r125 T G 7: 21,272,402 M75R probably damaging Het
Vwa3a T A 7: 120,773,030 D276E possibly damaging Het
Wdfy3 C T 5: 101,915,437 V1322M probably damaging Het
Wdr11 T C 7: 129,628,106 S872P possibly damaging Het
Zc3h13 T C 14: 75,321,721 S357P unknown Het
Other mutations in Birc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Birc2 APN 9 7833665 missense probably damaging 1.00
IGL00972:Birc2 APN 9 7833715 missense probably benign 0.36
IGL02888:Birc2 APN 9 7819558 missense probably benign 0.22
IGL03399:Birc2 APN 9 7821087 missense probably damaging 1.00
1mM(1):Birc2 UTSW 9 7819408 missense probably damaging 0.98
R0409:Birc2 UTSW 9 7819384 missense possibly damaging 0.61
R1617:Birc2 UTSW 9 7826951 missense possibly damaging 0.66
R1864:Birc2 UTSW 9 7819517 missense probably benign 0.06
R2156:Birc2 UTSW 9 7826938 missense probably damaging 1.00
R2519:Birc2 UTSW 9 7821179 missense possibly damaging 0.46
R2867:Birc2 UTSW 9 7834477 start codon destroyed probably null 0.08
R2867:Birc2 UTSW 9 7834477 start codon destroyed probably null 0.08
R4028:Birc2 UTSW 9 7819351 missense probably benign 0.01
R4243:Birc2 UTSW 9 7834385 missense probably benign 0.00
R4250:Birc2 UTSW 9 7818935 missense probably benign 0.00
R4584:Birc2 UTSW 9 7833674 missense probably damaging 1.00
R4952:Birc2 UTSW 9 7836740 missense probably damaging 0.99
R5017:Birc2 UTSW 9 7818885 nonsense probably null
R6163:Birc2 UTSW 9 7819035 missense probably benign 0.15
R6789:Birc2 UTSW 9 7836965 intron probably benign
R6795:Birc2 UTSW 9 7833872 missense possibly damaging 0.81
R6941:Birc2 UTSW 9 7819468 missense probably benign 0.00
R7105:Birc2 UTSW 9 7819441 missense probably damaging 1.00
R7233:Birc2 UTSW 9 7827008 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAGACACAGTCCTGTAGCTC -3'
(R):5'- CTCAGGCTTGTCATTGGAAGAG -3'

Sequencing Primer
(F):5'- CAGTCCTGTAGCTCAACAGC -3'
(R):5'- GTCATTGGAAGAGCAGTTGC -3'
Posted On2019-05-15