Incidental Mutation 'R7135:Mink1'
ID553015
Institutional Source Beutler Lab
Gene Symbol Mink1
Ensembl Gene ENSMUSG00000020827
Gene Namemisshapen-like kinase 1 (zebrafish)
SynonymsMap4k6, Ysk2, MINK, Misshapen/NIKs-related kinase
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7135 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location70562881-70614483 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70603503 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 243 (F243S)
Ref Sequence ENSEMBL: ENSMUSP00000099619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072237] [ENSMUST00000072873] [ENSMUST00000079244] [ENSMUST00000102558] [ENSMUST00000102559]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072237
AA Change: F243S

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000072091
Gene: ENSMUSG00000020827
AA Change: F243S

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 719 738 N/A INTRINSIC
low complexity region 837 874 N/A INTRINSIC
CNH 1026 1324 1.58e-113 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000072873
AA Change: F243S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072649
Gene: ENSMUSG00000020827
AA Change: F243S

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 719 738 N/A INTRINSIC
low complexity region 829 853 N/A INTRINSIC
CNH 1019 1317 1.58e-113 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000079244
AA Change: F243S

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000078234
Gene: ENSMUSG00000020827
AA Change: F243S

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 314 338 N/A INTRINSIC
coiled coil region 348 493 N/A INTRINSIC
low complexity region 554 566 N/A INTRINSIC
low complexity region 617 630 N/A INTRINSIC
low complexity region 643 656 N/A INTRINSIC
low complexity region 716 735 N/A INTRINSIC
low complexity region 826 850 N/A INTRINSIC
CNH 1016 1314 1.58e-113 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102558
AA Change: F243S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099618
Gene: ENSMUSG00000020827
AA Change: F243S

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 792 816 N/A INTRINSIC
CNH 982 1280 1.58e-113 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102559
AA Change: F243S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099619
Gene: ENSMUSG00000020827
AA Change: F243S

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 800 824 N/A INTRINSIC
CNH 990 1288 1.58e-113 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000117959
Gene: ENSMUSG00000020827
AA Change: F96S

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 140 2.3e-22 PFAM
Pfam:Pkinase 1 143 1.6e-30 PFAM
low complexity region 161 192 N/A INTRINSIC
coiled coil region 204 349 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
low complexity region 474 487 N/A INTRINSIC
low complexity region 500 513 N/A INTRINSIC
low complexity region 573 592 N/A INTRINSIC
low complexity region 691 728 N/A INTRINSIC
CNH 880 1178 1.58e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149845
Predicted Effect probably benign
Transcript: ENSMUST00000178764
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine kinase belonging to the germinal center kinase (GCK) family. The protein is structurally similar to the kinases that are related to NIK and may belong to a distinct subfamily of NIK-related kinases within the GCK family. Studies of the mouse homolog indicate an up-regulation of expression in the course of postnatal mouse cerebral development and activation of the cJun N-terminal kinase (JNK) and the p38 pathways. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016G14Rik T C 13: 24,741,506 S78P probably benign Het
Aars2 T A 17: 45,508,961 Y221* probably null Het
Ankmy2 T C 12: 36,196,312 S412P probably benign Het
Ap1s3 T C 1: 79,609,202 T144A probably benign Het
Asb3 T A 11: 30,998,501 L59* probably null Het
Asxl3 G T 18: 22,517,701 G916* probably null Het
Asxl3 G C 18: 22,517,702 G916A probably damaging Het
Birc2 A C 9: 7,818,761 F610V probably damaging Het
Camk4 G A 18: 33,107,943 probably null Het
Ccdc162 A G 10: 41,673,859 S343P probably benign Het
Ccnk T A 12: 108,186,475 L17Q probably damaging Het
Cd59b G A 2: 104,084,447 W63* probably null Het
Chrm3 C T 13: 9,877,801 V400I probably benign Het
Crb1 C A 1: 139,243,367 V762F probably damaging Het
Cspp1 C T 1: 10,088,936 T529I possibly damaging Het
Cttnbp2 A G 6: 18,448,447 I71T possibly damaging Het
Cyb561 C A 11: 105,935,567 G90V probably damaging Het
Cyld T A 8: 88,744,892 D804E possibly damaging Het
Ddx31 G A 2: 28,848,306 V160I probably benign Het
Dgkg T C 16: 22,500,382 D643G probably damaging Het
Dnah12 G A 14: 26,778,912 probably null Het
Dnah12 T G 14: 26,801,413 I1953S probably damaging Het
Dnah7b T C 1: 46,139,710 W848R probably damaging Het
Dnah7c C T 1: 46,533,208 T947M probably damaging Het
Dsp A T 13: 38,179,073 Y443F probably damaging Het
Espl1 T A 15: 102,319,524 C1603* probably null Het
Faiml G T 9: 99,234,443 R65S probably benign Het
Gfpt2 T C 11: 49,804,955 I4T probably damaging Het
Gm10376 T A 14: 43,010,493 M179L probably benign Het
Gm13084 A T 4: 143,810,663 L366Q probably damaging Het
Gm4302 T A 10: 100,341,727 M291K unknown Het
Gm8906 C T 5: 11,505,231 P83S probably damaging Het
Gnb1l T A 16: 18,545,168 D154E probably benign Het
Igkv10-94 T C 6: 68,704,743 R38G possibly damaging Het
Inmt A T 6: 55,171,028 Y205* probably null Het
Krba1 A G 6: 48,416,299 Q1049R probably benign Het
Lpxn T A 19: 12,833,319 C376S probably damaging Het
Lrrc52 T A 1: 167,466,450 I89F probably damaging Het
Map9 A T 3: 82,363,458 T110S probably benign Het
Mccc1 T C 3: 35,995,818 Y75C probably damaging Het
Mff T A 1: 82,747,091 L203* probably null Het
Micall1 C A 15: 79,109,424 D47E unknown Het
Mlycd C T 8: 119,402,477 R228W probably damaging Het
Msr1 A T 8: 39,589,424 V370E possibly damaging Het
Naip6 T C 13: 100,300,419 E532G probably damaging Het
Nepn G A 10: 52,391,719 C27Y probably damaging Het
Ninl T C 2: 150,955,604 H592R probably benign Het
Nr4a2 A G 2: 57,112,249 M64T possibly damaging Het
Olfr1279 T A 2: 111,307,020 F272I probably benign Het
Olfr484 T C 7: 108,124,574 K230E probably damaging Het
Pcbp1 A T 6: 86,525,506 M137K possibly damaging Het
Pcf11 A T 7: 92,657,316 S1215T probably benign Het
Pecam1 T C 11: 106,689,031 I402V probably damaging Het
Pex12 T C 11: 83,297,642 T176A probably benign Het
Phf3 T C 1: 30,831,109 K286R possibly damaging Het
Pik3ap1 T A 19: 41,332,321 D153V probably damaging Het
Pkhd1l1 T A 15: 44,584,978 probably null Het
Plekhn1 A G 4: 156,223,335 V378A probably benign Het
Ptprm A T 17: 66,944,288 D531E possibly damaging Het
Pum2 A T 12: 8,728,952 Q508L possibly damaging Het
Rad54l A G 4: 116,105,830 S324P probably damaging Het
Reln A T 5: 21,976,596 V1763D possibly damaging Het
Rp1 T C 1: 4,348,168 N907S possibly damaging Het
Scaf11 T A 15: 96,420,328 N452Y possibly damaging Het
Scgb2b3 T A 7: 31,360,214 H45L possibly damaging Het
Sim1 A G 10: 50,895,927 T11A probably damaging Het
Slc5a12 T A 2: 110,616,714 M189K possibly damaging Het
Slco2b1 C T 7: 99,695,063 G10S probably null Het
Stxbp3 A G 3: 108,800,755 L410P probably damaging Het
Sugct T C 13: 17,302,009 N297D probably benign Het
Syne1 A G 10: 5,233,409 I4132T probably benign Het
Teddm1b A T 1: 153,875,166 L240F probably damaging Het
Tlr5 C A 1: 182,975,523 D797E possibly damaging Het
Tmprss13 G T 9: 45,338,345 G327C probably damaging Het
Tnrc18 G T 5: 142,787,817 A419D Het
Ttc28 T C 5: 111,280,007 Y1790H probably damaging Het
Vmn1r125 T G 7: 21,272,402 M75R probably damaging Het
Vwa3a T A 7: 120,773,030 D276E possibly damaging Het
Wdfy3 C T 5: 101,915,437 V1322M probably damaging Het
Wdr11 T C 7: 129,628,106 S872P possibly damaging Het
Zc3h13 T C 14: 75,321,721 S357P unknown Het
Other mutations in Mink1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Mink1 APN 11 70603812 missense probably damaging 0.99
IGL00709:Mink1 APN 11 70613019 missense probably damaging 0.99
IGL01064:Mink1 APN 11 70603481 missense probably benign 0.05
IGL02612:Mink1 APN 11 70597226 missense probably damaging 1.00
IGL02797:Mink1 APN 11 70610350 missense probably damaging 1.00
IGL03056:Mink1 APN 11 70612583 critical splice donor site probably null
IGL03066:Mink1 APN 11 70608889 missense probably benign 0.01
IGL03185:Mink1 APN 11 70603860 missense probably damaging 1.00
PIT4498001:Mink1 UTSW 11 70598888 missense probably benign 0.05
R0025:Mink1 UTSW 11 70613042 missense probably damaging 1.00
R0025:Mink1 UTSW 11 70613042 missense probably damaging 1.00
R0488:Mink1 UTSW 11 70597204 missense probably damaging 1.00
R0637:Mink1 UTSW 11 70601676 missense probably damaging 0.96
R0828:Mink1 UTSW 11 70610145 nonsense probably null
R1081:Mink1 UTSW 11 70607035 missense probably benign 0.07
R1175:Mink1 UTSW 11 70611340 missense probably benign 0.02
R1441:Mink1 UTSW 11 70607114 missense possibly damaging 0.72
R1532:Mink1 UTSW 11 70602007 missense probably null 1.00
R1545:Mink1 UTSW 11 70598891 missense possibly damaging 0.60
R1634:Mink1 UTSW 11 70608880 missense probably benign 0.00
R1932:Mink1 UTSW 11 70608428 critical splice donor site probably null
R2033:Mink1 UTSW 11 70612508 missense probably damaging 1.00
R2184:Mink1 UTSW 11 70603797 missense probably damaging 1.00
R2267:Mink1 UTSW 11 70601724 splice site probably null
R2268:Mink1 UTSW 11 70601724 splice site probably null
R2859:Mink1 UTSW 11 70612508 missense probably damaging 1.00
R3713:Mink1 UTSW 11 70608950 missense possibly damaging 0.93
R3714:Mink1 UTSW 11 70608950 missense possibly damaging 0.93
R3715:Mink1 UTSW 11 70608950 missense possibly damaging 0.93
R3716:Mink1 UTSW 11 70607761 missense probably damaging 0.98
R3717:Mink1 UTSW 11 70607761 missense probably damaging 0.98
R4607:Mink1 UTSW 11 70606067 missense possibly damaging 0.72
R4735:Mink1 UTSW 11 70609260 splice site probably null
R4790:Mink1 UTSW 11 70599041 missense probably damaging 0.99
R4847:Mink1 UTSW 11 70602028 missense probably damaging 1.00
R4860:Mink1 UTSW 11 70611592 missense probably damaging 0.98
R4860:Mink1 UTSW 11 70611592 missense probably damaging 0.98
R5081:Mink1 UTSW 11 70605144 missense probably damaging 0.98
R5310:Mink1 UTSW 11 70607343 missense probably benign 0.33
R5677:Mink1 UTSW 11 70605165 missense possibly damaging 0.66
R5767:Mink1 UTSW 11 70606075 missense possibly damaging 0.53
R5795:Mink1 UTSW 11 70607790 missense possibly damaging 0.86
R5888:Mink1 UTSW 11 70610059 unclassified probably benign
R5950:Mink1 UTSW 11 70609586 missense possibly damaging 0.81
R6024:Mink1 UTSW 11 70599089 missense possibly damaging 0.71
R6034:Mink1 UTSW 11 70607040 small deletion probably benign
R6034:Mink1 UTSW 11 70607040 small deletion probably benign
R6058:Mink1 UTSW 11 70611720 missense possibly damaging 0.96
R6144:Mink1 UTSW 11 70610652 missense possibly damaging 0.66
R6154:Mink1 UTSW 11 70610101 missense possibly damaging 0.46
R6218:Mink1 UTSW 11 70598894 missense possibly damaging 0.94
R6262:Mink1 UTSW 11 70603325 splice site probably null
R6269:Mink1 UTSW 11 70598987 missense probably damaging 1.00
R6273:Mink1 UTSW 11 70611435 nonsense probably null
R6301:Mink1 UTSW 11 70612294 missense possibly damaging 0.71
R6603:Mink1 UTSW 11 70609593 missense probably damaging 0.96
R6876:Mink1 UTSW 11 70607435 missense probably benign 0.02
R7030:Mink1 UTSW 11 70607775 missense possibly damaging 0.46
R7050:Mink1 UTSW 11 70612332 missense possibly damaging 0.93
R7094:Mink1 UTSW 11 70610075 splice site probably null
R7238:Mink1 UTSW 11 70611479 critical splice donor site probably null
R7320:Mink1 UTSW 11 70599073 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TCTCTAGGAATCACAGCCATTG -3'
(R):5'- ATCCCTGTAGTTGCTGCCTG -3'

Sequencing Primer
(F):5'- CTCTAGGAATCACAGCCATTGAAATG -3'
(R):5'- GCCTGCAGTTCCCACAC -3'
Posted On2019-05-15