Incidental Mutation 'R7135:Pum2'
ID553019
Institutional Source Beutler Lab
Gene Symbol Pum2
Ensembl Gene ENSMUSG00000020594
Gene Namepumilio RNA-binding family member 2
Synonyms5730503J23Rik, Pumm2
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.615) question?
Stock #R7135 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location8674134-8752581 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 8728952 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 508 (Q508L)
Ref Sequence ENSEMBL: ENSMUSP00000131074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020915] [ENSMUST00000111122] [ENSMUST00000111123] [ENSMUST00000163569] [ENSMUST00000165293] [ENSMUST00000168361] [ENSMUST00000169089] [ENSMUST00000178015]
PDB Structure
Structure and RNA binding of the mouse Pumilio-2 Puf Domain [X-RAY DIFFRACTION]
Structure and RNA binding of the mouse Pumilio-2 Puf Domain [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020915
AA Change: Q503L

PolyPhen 2 Score 0.793 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000020915
Gene: ENSMUSG00000020594
AA Change: Q503L

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 319 336 N/A INTRINSIC
low complexity region 353 378 N/A INTRINSIC
low complexity region 464 490 N/A INTRINSIC
low complexity region 498 509 N/A INTRINSIC
low complexity region 521 535 N/A INTRINSIC
low complexity region 542 576 N/A INTRINSIC
low complexity region 591 609 N/A INTRINSIC
Pumilio 642 677 2.35e-7 SMART
Pumilio 678 713 6.54e-6 SMART
Pumilio 714 749 2.89e-7 SMART
Pumilio 750 785 3.37e-8 SMART
Pumilio 786 821 4.84e-9 SMART
Pumilio 822 857 3.2e-9 SMART
Pumilio 858 893 5.78e-7 SMART
Pumilio 901 936 3.62e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111122
AA Change: Q508L

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000106751
Gene: ENSMUSG00000020594
AA Change: Q508L

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 358 383 N/A INTRINSIC
low complexity region 469 495 N/A INTRINSIC
low complexity region 503 514 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
low complexity region 547 602 N/A INTRINSIC
low complexity region 630 660 N/A INTRINSIC
low complexity region 675 693 N/A INTRINSIC
Pumilio 726 761 2.35e-7 SMART
Pumilio 762 797 6.54e-6 SMART
Pumilio 798 833 2.89e-7 SMART
Pumilio 834 869 3.37e-8 SMART
Pumilio 870 905 4.84e-9 SMART
Pumilio 906 941 3.2e-9 SMART
Pumilio 942 977 5.78e-7 SMART
Pumilio 985 1020 3.62e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111123
AA Change: Q508L

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000106752
Gene: ENSMUSG00000020594
AA Change: Q508L

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 358 383 N/A INTRINSIC
low complexity region 469 495 N/A INTRINSIC
low complexity region 503 514 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
low complexity region 547 602 N/A INTRINSIC
low complexity region 630 660 N/A INTRINSIC
low complexity region 675 693 N/A INTRINSIC
Pumilio 726 761 2.35e-7 SMART
Pumilio 762 797 6.54e-6 SMART
Pumilio 798 833 2.89e-7 SMART
Pumilio 834 869 3.37e-8 SMART
Pumilio 870 905 4.84e-9 SMART
Pumilio 906 941 3.2e-9 SMART
Pumilio 942 977 5.78e-7 SMART
Pumilio 985 1020 3.62e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000163569
AA Change: Q508L

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000131074
Gene: ENSMUSG00000020594
AA Change: Q508L

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 358 383 N/A INTRINSIC
low complexity region 469 495 N/A INTRINSIC
low complexity region 503 514 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
low complexity region 547 602 N/A INTRINSIC
low complexity region 630 660 N/A INTRINSIC
low complexity region 675 693 N/A INTRINSIC
Pumilio 726 761 2.35e-7 SMART
Pumilio 762 797 6.54e-6 SMART
Pumilio 798 832 1.29e-4 SMART
Pumilio 836 871 3.37e-8 SMART
Pumilio 872 907 4.84e-9 SMART
Pumilio 908 943 3.2e-9 SMART
Pumilio 944 979 5.78e-7 SMART
Pumilio 987 1022 3.62e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164818
SMART Domains Protein: ENSMUSP00000129243
Gene: ENSMUSG00000020594

DomainStartEndE-ValueType
low complexity region 24 42 N/A INTRINSIC
Pumilio 75 110 2.35e-7 SMART
Pumilio 111 139 1.58e1 SMART
Pumilio 140 175 3.37e-8 SMART
Pumilio 176 211 4.84e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165293
Predicted Effect possibly damaging
Transcript: ENSMUST00000168361
AA Change: Q508L

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000128292
Gene: ENSMUSG00000020594
AA Change: Q508L

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 358 383 N/A INTRINSIC
low complexity region 469 495 N/A INTRINSIC
low complexity region 503 514 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
low complexity region 547 602 N/A INTRINSIC
low complexity region 630 660 N/A INTRINSIC
low complexity region 675 693 N/A INTRINSIC
Pumilio 726 761 2.35e-7 SMART
Pumilio 762 797 6.54e-6 SMART
Pumilio 798 832 1.29e-4 SMART
Pumilio 836 871 3.37e-8 SMART
Pumilio 872 907 4.84e-9 SMART
Pumilio 908 943 3.2e-9 SMART
Pumilio 944 979 5.78e-7 SMART
Pumilio 987 1022 3.62e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000169089
AA Change: Q508L

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132122
Gene: ENSMUSG00000020594
AA Change: Q508L

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 358 383 N/A INTRINSIC
low complexity region 469 495 N/A INTRINSIC
low complexity region 503 514 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
low complexity region 547 581 N/A INTRINSIC
low complexity region 596 614 N/A INTRINSIC
Pumilio 647 682 2.35e-7 SMART
Pumilio 683 718 6.54e-6 SMART
Pumilio 719 754 2.89e-7 SMART
Pumilio 755 790 3.37e-8 SMART
Pumilio 791 826 4.84e-9 SMART
Pumilio 827 862 3.2e-9 SMART
Pumilio 863 898 5.78e-7 SMART
Pumilio 906 941 3.62e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000178015
AA Change: Q508L

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000137020
Gene: ENSMUSG00000020594
AA Change: Q508L

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 358 383 N/A INTRINSIC
low complexity region 469 495 N/A INTRINSIC
low complexity region 503 514 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
low complexity region 547 581 N/A INTRINSIC
low complexity region 596 614 N/A INTRINSIC
Pumilio 647 682 2.35e-7 SMART
Pumilio 683 718 6.54e-6 SMART
Pumilio 719 754 2.89e-7 SMART
Pumilio 755 790 3.37e-8 SMART
Pumilio 791 826 4.84e-9 SMART
Pumilio 827 862 3.2e-9 SMART
Pumilio 863 898 5.78e-7 SMART
Pumilio 906 941 3.62e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to a family of RNA-binding proteins. The encoded protein functions as a translational repressor during embryonic development and cell differentiation. This protein is also thought to be a positive regulator of cell proliferation in adipose-derived stem cells. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit significantly smaller testes and seminiferous tubule degeneration but are otherwise viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016G14Rik T C 13: 24,741,506 S78P probably benign Het
Aars2 T A 17: 45,508,961 Y221* probably null Het
Ankmy2 T C 12: 36,196,312 S412P probably benign Het
Ap1s3 T C 1: 79,609,202 T144A probably benign Het
Asb3 T A 11: 30,998,501 L59* probably null Het
Asxl3 G T 18: 22,517,701 G916* probably null Het
Asxl3 G C 18: 22,517,702 G916A probably damaging Het
Birc2 A C 9: 7,818,761 F610V probably damaging Het
Camk4 G A 18: 33,107,943 probably null Het
Ccdc162 A G 10: 41,673,859 S343P probably benign Het
Ccnk T A 12: 108,186,475 L17Q probably damaging Het
Cd59b G A 2: 104,084,447 W63* probably null Het
Chrm3 C T 13: 9,877,801 V400I probably benign Het
Crb1 C A 1: 139,243,367 V762F probably damaging Het
Cspp1 C T 1: 10,088,936 T529I possibly damaging Het
Cttnbp2 A G 6: 18,448,447 I71T possibly damaging Het
Cyb561 C A 11: 105,935,567 G90V probably damaging Het
Cyld T A 8: 88,744,892 D804E possibly damaging Het
Ddx31 G A 2: 28,848,306 V160I probably benign Het
Dgkg T C 16: 22,500,382 D643G probably damaging Het
Dnah12 G A 14: 26,778,912 probably null Het
Dnah12 T G 14: 26,801,413 I1953S probably damaging Het
Dnah7b T C 1: 46,139,710 W848R probably damaging Het
Dnah7c C T 1: 46,533,208 T947M probably damaging Het
Dsp A T 13: 38,179,073 Y443F probably damaging Het
Espl1 T A 15: 102,319,524 C1603* probably null Het
Faiml G T 9: 99,234,443 R65S probably benign Het
Gfpt2 T C 11: 49,804,955 I4T probably damaging Het
Gm10376 T A 14: 43,010,493 M179L probably benign Het
Gm13084 A T 4: 143,810,663 L366Q probably damaging Het
Gm4302 T A 10: 100,341,727 M291K unknown Het
Gm8906 C T 5: 11,505,231 P83S probably damaging Het
Gnb1l T A 16: 18,545,168 D154E probably benign Het
Igkv10-94 T C 6: 68,704,743 R38G possibly damaging Het
Inmt A T 6: 55,171,028 Y205* probably null Het
Krba1 A G 6: 48,416,299 Q1049R probably benign Het
Lpxn T A 19: 12,833,319 C376S probably damaging Het
Lrrc52 T A 1: 167,466,450 I89F probably damaging Het
Map9 A T 3: 82,363,458 T110S probably benign Het
Mccc1 T C 3: 35,995,818 Y75C probably damaging Het
Mff T A 1: 82,747,091 L203* probably null Het
Micall1 C A 15: 79,109,424 D47E unknown Het
Mink1 T C 11: 70,603,503 F243S probably damaging Het
Mlycd C T 8: 119,402,477 R228W probably damaging Het
Msr1 A T 8: 39,589,424 V370E possibly damaging Het
Naip6 T C 13: 100,300,419 E532G probably damaging Het
Nepn G A 10: 52,391,719 C27Y probably damaging Het
Ninl T C 2: 150,955,604 H592R probably benign Het
Nr4a2 A G 2: 57,112,249 M64T possibly damaging Het
Olfr1279 T A 2: 111,307,020 F272I probably benign Het
Olfr484 T C 7: 108,124,574 K230E probably damaging Het
Pcbp1 A T 6: 86,525,506 M137K possibly damaging Het
Pcf11 A T 7: 92,657,316 S1215T probably benign Het
Pecam1 T C 11: 106,689,031 I402V probably damaging Het
Pex12 T C 11: 83,297,642 T176A probably benign Het
Phf3 T C 1: 30,831,109 K286R possibly damaging Het
Pik3ap1 T A 19: 41,332,321 D153V probably damaging Het
Pkhd1l1 T A 15: 44,584,978 probably null Het
Plekhn1 A G 4: 156,223,335 V378A probably benign Het
Ptprm A T 17: 66,944,288 D531E possibly damaging Het
Rad54l A G 4: 116,105,830 S324P probably damaging Het
Reln A T 5: 21,976,596 V1763D possibly damaging Het
Rp1 T C 1: 4,348,168 N907S possibly damaging Het
Scaf11 T A 15: 96,420,328 N452Y possibly damaging Het
Scgb2b3 T A 7: 31,360,214 H45L possibly damaging Het
Sim1 A G 10: 50,895,927 T11A probably damaging Het
Slc5a12 T A 2: 110,616,714 M189K possibly damaging Het
Slco2b1 C T 7: 99,695,063 G10S probably null Het
Stxbp3 A G 3: 108,800,755 L410P probably damaging Het
Sugct T C 13: 17,302,009 N297D probably benign Het
Syne1 A G 10: 5,233,409 I4132T probably benign Het
Teddm1b A T 1: 153,875,166 L240F probably damaging Het
Tlr5 C A 1: 182,975,523 D797E possibly damaging Het
Tmprss13 G T 9: 45,338,345 G327C probably damaging Het
Tnrc18 G T 5: 142,787,817 A419D Het
Ttc28 T C 5: 111,280,007 Y1790H probably damaging Het
Vmn1r125 T G 7: 21,272,402 M75R probably damaging Het
Vwa3a T A 7: 120,773,030 D276E possibly damaging Het
Wdfy3 C T 5: 101,915,437 V1322M probably damaging Het
Wdr11 T C 7: 129,628,106 S872P possibly damaging Het
Zc3h13 T C 14: 75,321,721 S357P unknown Het
Other mutations in Pum2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Pum2 APN 12 8733381 missense probably damaging 1.00
IGL02118:Pum2 APN 12 8729117 missense probably benign 0.31
IGL02185:Pum2 APN 12 8748955 critical splice donor site probably null
IGL02528:Pum2 APN 12 8728696 nonsense probably null
IGL02718:Pum2 APN 12 8733344 missense probably benign 0.02
PIT4366001:Pum2 UTSW 12 8733390 missense probably damaging 1.00
R0152:Pum2 UTSW 12 8728754 missense possibly damaging 0.94
R0317:Pum2 UTSW 12 8728754 missense possibly damaging 0.94
R0357:Pum2 UTSW 12 8721785 missense possibly damaging 0.92
R0413:Pum2 UTSW 12 8713464 missense probably benign 0.00
R0494:Pum2 UTSW 12 8721736 nonsense probably null
R0520:Pum2 UTSW 12 8721710 missense probably damaging 1.00
R0727:Pum2 UTSW 12 8744465 missense probably damaging 1.00
R1576:Pum2 UTSW 12 8713524 missense probably benign 0.01
R2035:Pum2 UTSW 12 8728638 nonsense probably null
R2060:Pum2 UTSW 12 8728726 nonsense probably null
R2422:Pum2 UTSW 12 8748931 missense possibly damaging 0.70
R2437:Pum2 UTSW 12 8744654 missense probably benign 0.19
R3767:Pum2 UTSW 12 8719076 nonsense probably null
R4715:Pum2 UTSW 12 8747272 missense probably damaging 1.00
R5155:Pum2 UTSW 12 8713572 missense possibly damaging 0.79
R5226:Pum2 UTSW 12 8713458 missense possibly damaging 0.73
R5323:Pum2 UTSW 12 8744706 missense probably damaging 1.00
R6250:Pum2 UTSW 12 8744755 splice site probably null
R6253:Pum2 UTSW 12 8748205 missense probably damaging 1.00
R6508:Pum2 UTSW 12 8748861 missense probably benign 0.17
R6953:Pum2 UTSW 12 8728779 critical splice donor site probably null
X0039:Pum2 UTSW 12 8728944 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TTAATGGCTCCAACACCTGTC -3'
(R):5'- CACTGAGAGCTGAGCCTATAGC -3'

Sequencing Primer
(F):5'- TGGCTCCAACACCTGTCTTAATAAG -3'
(R):5'- GCCTATAGCAGCTCCTAAAGAG -3'
Posted On2019-05-15