Incidental Mutation 'R7135:Naip6'
ID553026
Institutional Source Beutler Lab
Gene Symbol Naip6
Ensembl Gene ENSMUSG00000078942
Gene NameNLR family, apoptosis inhibitory protein 6
SynonymsBirc1f, Naip-rs4, Naip-rs4A
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R7135 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location100281121-100317674 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100300419 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 532 (E532G)
Ref Sequence ENSEMBL: ENSMUSP00000041766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042220] [ENSMUST00000118574]
Predicted Effect probably damaging
Transcript: ENSMUST00000042220
AA Change: E532G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041766
Gene: ENSMUSG00000078942
AA Change: E532G

DomainStartEndE-ValueType
BIR 58 129 6.21e-20 SMART
BIR 157 229 8.04e-37 SMART
BIR 276 347 5.19e-31 SMART
Pfam:NACHT 464 618 7.6e-37 PFAM
low complexity region 851 862 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118574
AA Change: E532G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112867
Gene: ENSMUSG00000078942
AA Change: E532G

DomainStartEndE-ValueType
BIR 58 129 6.21e-20 SMART
BIR 157 229 8.04e-37 SMART
BIR 276 347 5.19e-31 SMART
Pfam:NACHT 464 618 2.5e-35 PFAM
low complexity region 851 862 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Closest sequence match is AF381772. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016G14Rik T C 13: 24,741,506 S78P probably benign Het
Aars2 T A 17: 45,508,961 Y221* probably null Het
Ankmy2 T C 12: 36,196,312 S412P probably benign Het
Ap1s3 T C 1: 79,609,202 T144A probably benign Het
Asb3 T A 11: 30,998,501 L59* probably null Het
Asxl3 G T 18: 22,517,701 G916* probably null Het
Asxl3 G C 18: 22,517,702 G916A probably damaging Het
Birc2 A C 9: 7,818,761 F610V probably damaging Het
Camk4 G A 18: 33,107,943 probably null Het
Ccdc162 A G 10: 41,673,859 S343P probably benign Het
Ccnk T A 12: 108,186,475 L17Q probably damaging Het
Cd59b G A 2: 104,084,447 W63* probably null Het
Chrm3 C T 13: 9,877,801 V400I probably benign Het
Crb1 C A 1: 139,243,367 V762F probably damaging Het
Cspp1 C T 1: 10,088,936 T529I possibly damaging Het
Cttnbp2 A G 6: 18,448,447 I71T possibly damaging Het
Cyb561 C A 11: 105,935,567 G90V probably damaging Het
Cyld T A 8: 88,744,892 D804E possibly damaging Het
Ddx31 G A 2: 28,848,306 V160I probably benign Het
Dgkg T C 16: 22,500,382 D643G probably damaging Het
Dnah12 G A 14: 26,778,912 probably null Het
Dnah12 T G 14: 26,801,413 I1953S probably damaging Het
Dnah7b T C 1: 46,139,710 W848R probably damaging Het
Dnah7c C T 1: 46,533,208 T947M probably damaging Het
Dsp A T 13: 38,179,073 Y443F probably damaging Het
Espl1 T A 15: 102,319,524 C1603* probably null Het
Faiml G T 9: 99,234,443 R65S probably benign Het
Gfpt2 T C 11: 49,804,955 I4T probably damaging Het
Gm10376 T A 14: 43,010,493 M179L probably benign Het
Gm13084 A T 4: 143,810,663 L366Q probably damaging Het
Gm4302 T A 10: 100,341,727 M291K unknown Het
Gm8906 C T 5: 11,505,231 P83S probably damaging Het
Gnb1l T A 16: 18,545,168 D154E probably benign Het
Igkv10-94 T C 6: 68,704,743 R38G possibly damaging Het
Inmt A T 6: 55,171,028 Y205* probably null Het
Krba1 A G 6: 48,416,299 Q1049R probably benign Het
Lpxn T A 19: 12,833,319 C376S probably damaging Het
Lrrc52 T A 1: 167,466,450 I89F probably damaging Het
Map9 A T 3: 82,363,458 T110S probably benign Het
Mccc1 T C 3: 35,995,818 Y75C probably damaging Het
Mff T A 1: 82,747,091 L203* probably null Het
Micall1 C A 15: 79,109,424 D47E unknown Het
Mink1 T C 11: 70,603,503 F243S probably damaging Het
Mlycd C T 8: 119,402,477 R228W probably damaging Het
Msr1 A T 8: 39,589,424 V370E possibly damaging Het
Nepn G A 10: 52,391,719 C27Y probably damaging Het
Ninl T C 2: 150,955,604 H592R probably benign Het
Nr4a2 A G 2: 57,112,249 M64T possibly damaging Het
Olfr1279 T A 2: 111,307,020 F272I probably benign Het
Olfr484 T C 7: 108,124,574 K230E probably damaging Het
Pcbp1 A T 6: 86,525,506 M137K possibly damaging Het
Pcf11 A T 7: 92,657,316 S1215T probably benign Het
Pecam1 T C 11: 106,689,031 I402V probably damaging Het
Pex12 T C 11: 83,297,642 T176A probably benign Het
Phf3 T C 1: 30,831,109 K286R possibly damaging Het
Pik3ap1 T A 19: 41,332,321 D153V probably damaging Het
Pkhd1l1 T A 15: 44,584,978 probably null Het
Plekhn1 A G 4: 156,223,335 V378A probably benign Het
Ptprm A T 17: 66,944,288 D531E possibly damaging Het
Pum2 A T 12: 8,728,952 Q508L possibly damaging Het
Rad54l A G 4: 116,105,830 S324P probably damaging Het
Reln A T 5: 21,976,596 V1763D possibly damaging Het
Rp1 T C 1: 4,348,168 N907S possibly damaging Het
Scaf11 T A 15: 96,420,328 N452Y possibly damaging Het
Scgb2b3 T A 7: 31,360,214 H45L possibly damaging Het
Sim1 A G 10: 50,895,927 T11A probably damaging Het
Slc5a12 T A 2: 110,616,714 M189K possibly damaging Het
Slco2b1 C T 7: 99,695,063 G10S probably null Het
Stxbp3 A G 3: 108,800,755 L410P probably damaging Het
Sugct T C 13: 17,302,009 N297D probably benign Het
Syne1 A G 10: 5,233,409 I4132T probably benign Het
Teddm1b A T 1: 153,875,166 L240F probably damaging Het
Tlr5 C A 1: 182,975,523 D797E possibly damaging Het
Tmprss13 G T 9: 45,338,345 G327C probably damaging Het
Tnrc18 G T 5: 142,787,817 A419D Het
Ttc28 T C 5: 111,280,007 Y1790H probably damaging Het
Vmn1r125 T G 7: 21,272,402 M75R probably damaging Het
Vwa3a T A 7: 120,773,030 D276E possibly damaging Het
Wdfy3 C T 5: 101,915,437 V1322M probably damaging Het
Wdr11 T C 7: 129,628,106 S872P possibly damaging Het
Zc3h13 T C 14: 75,321,721 S357P unknown Het
Other mutations in Naip6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00677:Naip6 APN 13 100316017 missense probably benign 0.03
IGL01123:Naip6 APN 13 100304438 missense probably benign 0.02
IGL01151:Naip6 APN 13 100299093 missense probably benign 0.00
IGL01382:Naip6 APN 13 100299856 missense possibly damaging 0.95
IGL01415:Naip6 APN 13 100303290 missense probably benign 0.17
IGL01654:Naip6 APN 13 100299345 missense probably benign 0.00
IGL01662:Naip6 APN 13 100300354 missense probably damaging 1.00
IGL01726:Naip6 APN 13 100303252 missense probably benign 0.02
IGL01810:Naip6 APN 13 100288095 splice site probably benign
IGL01867:Naip6 APN 13 100300312 missense probably benign 0.40
IGL01926:Naip6 APN 13 100300196 missense probably damaging 1.00
IGL01964:Naip6 APN 13 100298730 splice site probably benign
IGL02145:Naip6 APN 13 100296978 missense possibly damaging 0.77
IGL02160:Naip6 APN 13 100299425 missense probably benign 0.01
IGL02214:Naip6 APN 13 100316059 missense probably damaging 1.00
IGL02342:Naip6 APN 13 100303240 missense possibly damaging 0.69
IGL02568:Naip6 APN 13 100316272 missense probably damaging 1.00
IGL02573:Naip6 APN 13 100299471 nonsense probably null
IGL02680:Naip6 APN 13 100283748 missense probably benign
IGL02829:Naip6 APN 13 100300765 missense probably benign 0.11
IGL02833:Naip6 APN 13 100299613 missense probably damaging 1.00
IGL02851:Naip6 APN 13 100300660 missense probably benign 0.01
IGL02860:Naip6 APN 13 100300476 missense possibly damaging 0.95
IGL02886:Naip6 APN 13 100300476 missense possibly damaging 0.95
IGL03155:Naip6 APN 13 100316424 missense possibly damaging 0.62
R0032:Naip6 UTSW 13 100303237 missense probably benign 0.00
R0310:Naip6 UTSW 13 100308213 missense possibly damaging 0.72
R0437:Naip6 UTSW 13 100296924 missense possibly damaging 0.75
R0472:Naip6 UTSW 13 100302260 missense probably benign 0.02
R0560:Naip6 UTSW 13 100300600 missense probably benign 0.08
R0638:Naip6 UTSW 13 100300528 missense probably benign 0.00
R0792:Naip6 UTSW 13 100283766 missense possibly damaging 0.78
R0963:Naip6 UTSW 13 100316475 missense probably benign 0.11
R1102:Naip6 UTSW 13 100304415 missense possibly damaging 0.62
R1278:Naip6 UTSW 13 100300362 missense probably damaging 1.00
R1462:Naip6 UTSW 13 100300240 missense possibly damaging 0.64
R1462:Naip6 UTSW 13 100300240 missense possibly damaging 0.64
R1544:Naip6 UTSW 13 100316475 missense probably benign
R1595:Naip6 UTSW 13 100299094 missense probably damaging 0.96
R1749:Naip6 UTSW 13 100308255 missense probably benign 0.03
R1838:Naip6 UTSW 13 100316136 missense probably damaging 0.99
R1863:Naip6 UTSW 13 100300559 missense probably benign 0.03
R1914:Naip6 UTSW 13 100299428 missense probably benign 0.13
R2001:Naip6 UTSW 13 100300729 missense probably benign 0.44
R2082:Naip6 UTSW 13 100304344 splice site probably null
R2143:Naip6 UTSW 13 100299859 missense probably damaging 1.00
R2174:Naip6 UTSW 13 100298987 missense probably benign
R2266:Naip6 UTSW 13 100283559 missense possibly damaging 0.46
R2284:Naip6 UTSW 13 100300600 missense probably benign 0.08
R2285:Naip6 UTSW 13 100300600 missense probably benign 0.08
R2286:Naip6 UTSW 13 100300600 missense probably benign 0.08
R2351:Naip6 UTSW 13 100283661 missense probably damaging 1.00
R2363:Naip6 UTSW 13 100316420 missense possibly damaging 0.90
R2445:Naip6 UTSW 13 100300668 missense probably damaging 0.99
R2971:Naip6 UTSW 13 100300600 missense probably benign 0.08
R2975:Naip6 UTSW 13 100288187 missense probably damaging 1.00
R3081:Naip6 UTSW 13 100300453 missense probably benign
R3082:Naip6 UTSW 13 100316417 missense probably benign 0.00
R3122:Naip6 UTSW 13 100316523 missense probably benign 0.00
R3417:Naip6 UTSW 13 100300600 missense probably benign 0.08
R3943:Naip6 UTSW 13 100294739 missense probably benign 0.01
R3944:Naip6 UTSW 13 100294739 missense probably benign 0.01
R4080:Naip6 UTSW 13 100299307 missense probably damaging 1.00
R4166:Naip6 UTSW 13 100316149 missense probably benign 0.23
R4396:Naip6 UTSW 13 100300600 missense probably benign 0.08
R4397:Naip6 UTSW 13 100300600 missense probably benign 0.08
R4418:Naip6 UTSW 13 100300600 missense probably benign 0.08
R4512:Naip6 UTSW 13 100300600 missense probably benign 0.08
R4670:Naip6 UTSW 13 100294731 critical splice donor site probably null
R4671:Naip6 UTSW 13 100294731 critical splice donor site probably null
R4722:Naip6 UTSW 13 100307072 missense possibly damaging 0.72
R4811:Naip6 UTSW 13 100285791 missense probably damaging 1.00
R4900:Naip6 UTSW 13 100296969 missense probably damaging 0.99
R5162:Naip6 UTSW 13 100300600 missense probably benign 0.08
R5316:Naip6 UTSW 13 100283782 missense probably benign 0.00
R5403:Naip6 UTSW 13 100300077 missense probably benign 0.12
R5437:Naip6 UTSW 13 100303304 nonsense probably null
R5507:Naip6 UTSW 13 100298915 missense probably benign 0.01
R5631:Naip6 UTSW 13 100300138 missense probably benign 0.02
R5657:Naip6 UTSW 13 100300401 missense probably benign
R5684:Naip6 UTSW 13 100300380 missense probably damaging 1.00
R5786:Naip6 UTSW 13 100300216 missense probably benign
R5787:Naip6 UTSW 13 100300216 missense probably benign
R5788:Naip6 UTSW 13 100300216 missense probably benign
R5878:Naip6 UTSW 13 100299673 missense probably damaging 1.00
R5895:Naip6 UTSW 13 100315992 missense possibly damaging 0.90
R5898:Naip6 UTSW 13 100299321 missense possibly damaging 0.93
R6113:Naip6 UTSW 13 100299286 missense possibly damaging 0.96
R6141:Naip6 UTSW 13 100308233 missense possibly damaging 0.91
R6199:Naip6 UTSW 13 100300600 missense probably benign 0.08
R6321:Naip6 UTSW 13 100300401 missense probably benign
R6402:Naip6 UTSW 13 100300718 missense probably benign 0.30
R6435:Naip6 UTSW 13 100294741 missense probably benign 0.04
R6477:Naip6 UTSW 13 100316008 missense probably damaging 1.00
R6601:Naip6 UTSW 13 100283758 missense probably benign
R6638:Naip6 UTSW 13 100300401 missense probably benign
R6639:Naip6 UTSW 13 100300401 missense probably benign
R6804:Naip6 UTSW 13 100299167 missense probably benign
R6922:Naip6 UTSW 13 100302198 missense possibly damaging 0.88
R6975:Naip6 UTSW 13 100316265 missense probably damaging 1.00
R7050:Naip6 UTSW 13 100315499 missense probably damaging 1.00
R7140:Naip6 UTSW 13 100300200 missense possibly damaging 0.95
R7182:Naip6 UTSW 13 100316149 missense probably benign 0.23
R7196:Naip6 UTSW 13 100300158 missense probably benign 0.10
R7234:Naip6 UTSW 13 100315503 nonsense probably null
R7259:Naip6 UTSW 13 100304355 missense probably damaging 1.00
R7322:Naip6 UTSW 13 100299388 missense possibly damaging 0.94
X0066:Naip6 UTSW 13 100315462 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TACCTAGGTATGGGCGGATG -3'
(R):5'- AATCTCAGCTCTGTCATGTGTG -3'

Sequencing Primer
(F):5'- ATGTCTCTGACCCTGTTTGTATGAAC -3'
(R):5'- GCTGGAAGTGGAAAGACAACCTTC -3'
Posted On2019-05-15