Incidental Mutation 'R7136:Fbxl19'
ID553073
Institutional Source Beutler Lab
Gene Symbol Fbxl19
Ensembl Gene ENSMUSG00000030811
Gene NameF-box and leucine-rich repeat protein 19
SynonymsFbl19
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.912) question?
Stock #R7136 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location127744543-127769483 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 127750045 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 129 (T129N)
Ref Sequence ENSEMBL: ENSMUSP00000033081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033081] [ENSMUST00000186116] [ENSMUST00000186207] [ENSMUST00000188580] [ENSMUST00000189562] [ENSMUST00000205689] [ENSMUST00000206893]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033081
AA Change: T129N

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000033081
Gene: ENSMUSG00000030811
AA Change: T129N

DomainStartEndE-ValueType
Pfam:zf-CXXC 11 57 1.7e-16 PFAM
PHD 67 129 4e-4 SMART
low complexity region 166 183 N/A INTRINSIC
low complexity region 302 325 N/A INTRINSIC
low complexity region 355 377 N/A INTRINSIC
FBOX 404 444 4.6e-4 SMART
low complexity region 509 520 N/A INTRINSIC
LRR 576 601 3.58e1 SMART
LRR 631 656 1.28e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186116
SMART Domains Protein: ENSMUSP00000140083
Gene: ENSMUSG00000030811

DomainStartEndE-ValueType
low complexity region 10 33 N/A INTRINSIC
low complexity region 63 85 N/A INTRINSIC
FBOX 112 152 3e-6 SMART
low complexity region 217 228 N/A INTRINSIC
LRR 284 309 1.5e-1 SMART
LRR 339 364 5.3e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000186207
AA Change: T129N

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140303
Gene: ENSMUSG00000030811
AA Change: T129N

DomainStartEndE-ValueType
Pfam:zf-CXXC 11 57 1.7e-16 PFAM
PHD 67 129 4e-4 SMART
low complexity region 166 183 N/A INTRINSIC
low complexity region 302 325 N/A INTRINSIC
low complexity region 355 377 N/A INTRINSIC
FBOX 404 444 4.6e-4 SMART
low complexity region 509 520 N/A INTRINSIC
LRR 576 601 3.58e1 SMART
LRR 631 656 1.28e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188580
AA Change: T129N

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000140021
Gene: ENSMUSG00000030811
AA Change: T129N

DomainStartEndE-ValueType
Pfam:zf-CXXC 11 57 1.3e-16 PFAM
PHD 67 129 4e-4 SMART
low complexity region 186 209 N/A INTRINSIC
low complexity region 239 261 N/A INTRINSIC
FBOX 288 328 4.6e-4 SMART
low complexity region 393 404 N/A INTRINSIC
LRR 460 485 3.58e1 SMART
LRR 515 540 1.28e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189562
SMART Domains Protein: ENSMUSP00000139972
Gene: ENSMUSG00000030811

DomainStartEndE-ValueType
Pfam:zf-CXXC 11 57 9.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205689
Predicted Effect probably benign
Transcript: ENSMUST00000206893
AA Change: T129N

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Skp1-Cullin-F-box family of E3 ubiquitin ligases. The encoded protein is reported to bind to the transmembrane receptor interleukin 1 receptor-like 1 and regulate its ubiquitination and degradation. This protein has been linked to the regulation of pulmonary inflammation and psoriasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik A T 5: 5,466,631 D63E possibly damaging Het
1700123K08Rik A G 5: 138,562,348 S262P probably damaging Het
Abcc2 A G 19: 43,837,460 E1512G probably damaging Het
Abcg2 T G 6: 58,684,340 Y459D possibly damaging Het
Amy1 T C 3: 113,563,599 Y197C probably damaging Het
Bptf A G 11: 107,099,715 I516T probably damaging Het
Capn12 T A 7: 28,883,107 probably null Het
Cbln2 T A 18: 86,716,672 L190Q probably damaging Het
Ccdc157 C T 11: 4,148,592 E305K possibly damaging Het
Ccdc47 A G 11: 106,205,004 S289P probably benign Het
Chd3 C T 11: 69,348,438 E1756K probably null Het
Chrd G T 16: 20,734,522 A183S possibly damaging Het
Cp C T 3: 19,985,658 R880* probably null Het
Cyp24a1 A T 2: 170,494,143 D191E probably benign Het
Dnah1 T C 14: 31,298,656 Y1252C probably damaging Het
Eps8l1 A G 7: 4,477,404 D487G probably damaging Het
Fam227b T G 2: 126,124,028 Q159P probably damaging Het
Fat3 A G 9: 16,378,185 I14T probably benign Het
Fuca2 T C 10: 13,505,921 F193L probably benign Het
Gm10037 A G 13: 67,842,992 probably null Het
H2-Q1 T C 17: 35,320,627 probably null Het
Hgh1 A G 15: 76,370,431 M336V probably benign Het
Il12b T C 11: 44,408,030 L104P probably benign Het
Kcnh2 A T 5: 24,332,991 F125I probably benign Het
Kcnk7 A G 19: 5,706,076 H110R probably benign Het
Kdm3a G A 6: 71,611,780 P415L probably benign Het
Kifc3 T C 8: 95,103,449 T610A probably benign Het
Lmbr1l C A 15: 98,911,491 probably null Het
Lmo7 T A 14: 101,920,539 M1436K unknown Het
Lrp1 C T 10: 127,558,622 C2574Y probably damaging Het
Med13l A G 5: 118,721,522 E258G possibly damaging Het
Mesp1 T C 7: 79,793,158 I124V probably damaging Het
Mrgpra2a A T 7: 47,427,186 I108N probably benign Het
Nos1 G T 5: 117,895,860 R349L possibly damaging Het
Olfr1356 T C 10: 78,847,781 I45V probably benign Het
Olfr195 C T 16: 59,148,964 T38I probably damaging Het
Osgin1 T A 8: 119,441,437 M1K probably null Het
Pde4dip C T 3: 97,694,063 S2346N probably benign Het
Pde7a T C 3: 19,231,094 M310V probably benign Het
Pigw G A 11: 84,877,759 T248M probably damaging Het
Pink1 T C 4: 138,317,458 T323A probably damaging Het
Polr3a C T 14: 24,461,815 R891Q probably damaging Het
Prkar1b C A 5: 139,108,608 C75F probably benign Het
Prss58 C T 6: 40,900,053 probably null Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Qars T C 9: 108,512,772 I350T probably damaging Het
Qprt T C 7: 127,108,812 K149R probably damaging Het
Rasgrf1 T A 9: 89,991,598 D653E probably damaging Het
Rbm26 T C 14: 105,144,267 M481V possibly damaging Het
Rdx C T 9: 52,086,445 T573M probably damaging Het
Rgs14 A G 13: 55,379,695 probably null Het
Robo2 T C 16: 73,956,550 E813G probably damaging Het
Rrbp1 A T 2: 143,949,680 F1369I probably benign Het
Sh2d4b T A 14: 40,840,252 T319S probably benign Het
Slc7a15 G T 12: 8,538,895 N217K probably damaging Het
Stmn1 A G 4: 134,470,777 K42E probably damaging Het
Tbl2 T G 5: 135,149,828 W31G probably benign Het
Tmem8b T C 4: 43,669,845 C114R possibly damaging Het
Tsc2 T C 17: 24,613,280 S711G probably benign Het
Ttn T C 2: 76,836,560 R11531G unknown Het
Ube2e3 T C 2: 78,913,741 Y105H probably benign Het
Usp16 G T 16: 87,483,171 C753F probably benign Het
Vmn1r13 T C 6: 57,210,254 S133P possibly damaging Het
Vmn2r76 T A 7: 86,228,767 Q474L probably benign Het
Vps52 T C 17: 33,965,288 I601T probably benign Het
Wasf1 A T 10: 40,926,591 T81S possibly damaging Het
Wdr82 A G 9: 106,171,333 S39G probably benign Het
Zdhhc13 A G 7: 48,801,332 I108V probably benign Het
Other mutations in Fbxl19
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0559:Fbxl19 UTSW 7 127750218 missense possibly damaging 0.51
R1933:Fbxl19 UTSW 7 127750929 missense probably benign
R2280:Fbxl19 UTSW 7 127748368 missense possibly damaging 0.80
R2935:Fbxl19 UTSW 7 127752260 missense probably damaging 0.97
R5580:Fbxl19 UTSW 7 127750996 nonsense probably null
R6032:Fbxl19 UTSW 7 127761265 missense probably damaging 1.00
R6032:Fbxl19 UTSW 7 127761265 missense probably damaging 1.00
R6054:Fbxl19 UTSW 7 127752509 missense probably damaging 0.99
R6540:Fbxl19 UTSW 7 127748353 utr 5 prime probably benign
R6825:Fbxl19 UTSW 7 127750015 missense probably damaging 0.99
X0060:Fbxl19 UTSW 7 127767803 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- CCTGAAGGTGATAATCCTGGGAAC -3'
(R):5'- AAGGGTCCCTTTCTTCTGGG -3'

Sequencing Primer
(F):5'- GAACCAACCCTGCAACCTGG -3'
(R):5'- CCCTTTCTTCTGGGCAGGG -3'
Posted On2019-05-15