Incidental Mutation 'R7137:Ces1c'
ID553133
Institutional Source Beutler Lab
Gene Symbol Ces1c
Ensembl Gene ENSMUSG00000057400
Gene Namecarboxylesterase 1C
SynonymsEs-4, Ces-N, Es1, Es-N, Ee-1, Es-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R7137 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location93099015-93131283 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93130842 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 37 (Y37C)
Ref Sequence ENSEMBL: ENSMUSP00000034189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034189]
Predicted Effect probably benign
Transcript: ENSMUST00000034189
AA Change: Y37C

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000034189
Gene: ENSMUSG00000057400
AA Change: Y37C

DomainStartEndE-ValueType
Pfam:COesterase 1 534 4e-167 PFAM
Pfam:Abhydrolase_3 136 235 6.2e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit protection against nerve agents such as chlorpyrifos and chlorpyrifos oxon but increased sensitivity to soman coumarin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,677,985 S1423P possibly damaging Het
Acvr1c A G 2: 58,283,387 probably null Het
Adgrf5 A G 17: 43,450,897 K1161R probably damaging Het
Arhgap32 T G 9: 32,151,936 D80E probably benign Het
Aspg T C 12: 112,112,198 V30A possibly damaging Het
Bcl2a1d T C 9: 88,731,478 D81G probably damaging Het
Cep170b T C 12: 112,735,167 V160A probably benign Het
Cntnap5a T C 1: 116,089,376 L233P probably damaging Het
Crem C A 18: 3,273,459 A245S possibly damaging Het
Cyp2d12 C T 15: 82,557,821 A280V probably benign Het
Dnah2 C T 11: 69,491,555 G1243D probably damaging Het
Emcn T G 3: 137,403,991 N131K probably damaging Het
Fat3 A T 9: 15,997,148 D2519E probably damaging Het
Fibin T A 2: 110,362,656 D47V probably damaging Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
Gimap8 C A 6: 48,650,253 L54I probably damaging Het
Gm20481 A G 17: 34,970,095 Y27C unknown Het
Gm21319 A T 12: 87,773,546 L81Q possibly damaging Het
Grin1 T G 2: 25,313,538 M154L probably benign Het
Ighv8-13 A G 12: 115,765,577 L20P probably damaging Het
Insc G A 7: 114,811,615 V236I probably benign Het
Lrrk1 A G 7: 66,285,279 F1031L probably benign Het
Man2a2 C A 7: 80,359,751 R785L probably benign Het
Mcur1 C A 13: 43,544,455 probably null Het
Med12l A C 3: 59,258,254 R1464S probably damaging Het
Mycbp2 A T 14: 103,282,679 M767K possibly damaging Het
Naalad2 T C 9: 18,323,487 I762V probably benign Het
Nfkbid A G 7: 30,426,256 T357A possibly damaging Het
Pcdh17 A G 14: 84,533,549 R1156G possibly damaging Het
Pcdhb1 T C 18: 37,267,392 S799P possibly damaging Het
Pde3a A T 6: 141,498,746 E1093D probably benign Het
Plcg1 T C 2: 160,753,926 Y572H possibly damaging Het
Plxna4 A G 6: 32,517,264 L139P probably damaging Het
Psma1 A G 7: 114,274,448 Y6H probably damaging Het
Psmd2 A G 16: 20,652,627 E76G probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Pyy T G 11: 102,107,273 D27A possibly damaging Het
Slc22a2 A G 17: 12,584,341 T21A probably benign Het
Slc25a2 T C 18: 37,638,147 I110V probably benign Het
Sult1c2 A C 17: 53,838,394 W85G probably damaging Het
Svs1 A G 6: 48,990,149 Y677C probably damaging Het
Syt12 C T 19: 4,453,950 D218N probably damaging Het
Tln1 C T 4: 43,540,616 V1462M probably damaging Het
Tor1aip2 T A 1: 156,051,976 N33K possibly damaging Het
Usp17lb C A 7: 104,841,591 W43L probably benign Het
Vmn1r76 A G 7: 11,930,685 Y201H possibly damaging Het
Wnk1 C A 6: 120,038,212 probably benign Het
Wrnip1 A G 13: 32,802,749 D171G probably benign Het
Zar1 T A 5: 72,580,816 N81I probably damaging Het
Zbtb45 T C 7: 13,007,156 T392A probably benign Het
Zfp445 T C 9: 122,854,778 E272G probably damaging Het
Other mutations in Ces1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Ces1c APN 8 93106673 missense probably benign 0.02
IGL00558:Ces1c APN 8 93099271 missense probably benign 0.03
IGL00787:Ces1c APN 8 93120366 missense possibly damaging 0.90
IGL00851:Ces1c APN 8 93123117 missense probably benign 0.00
IGL01598:Ces1c APN 8 93118413 missense probably benign
IGL02616:Ces1c APN 8 93106615 missense probably benign 0.01
IGL03087:Ces1c APN 8 93118414 missense probably benign
IGL03203:Ces1c APN 8 93124588 missense probably damaging 1.00
R0119:Ces1c UTSW 8 93106717 unclassified probably benign
R0119:Ces1c UTSW 8 93107610 missense probably benign 0.00
R0255:Ces1c UTSW 8 93127524 missense probably benign
R0759:Ces1c UTSW 8 93130864 nonsense probably null
R1499:Ces1c UTSW 8 93127605 missense probably benign 0.01
R1926:Ces1c UTSW 8 93127604 missense possibly damaging 0.69
R2087:Ces1c UTSW 8 93107602 missense probably benign 0.00
R2142:Ces1c UTSW 8 93130840 missense probably benign
R2442:Ces1c UTSW 8 93123212 missense probably damaging 1.00
R2971:Ces1c UTSW 8 93104193 missense probably benign 0.01
R3079:Ces1c UTSW 8 93120347 missense probably damaging 1.00
R3080:Ces1c UTSW 8 93120347 missense probably damaging 1.00
R3609:Ces1c UTSW 8 93120332 missense probably damaging 1.00
R4131:Ces1c UTSW 8 93100684 missense probably damaging 1.00
R4633:Ces1c UTSW 8 93118386 missense probably benign 0.00
R4988:Ces1c UTSW 8 93100708 missense probably damaging 1.00
R5081:Ces1c UTSW 8 93127569 missense probably damaging 1.00
R5497:Ces1c UTSW 8 93130715 missense possibly damaging 0.91
R5586:Ces1c UTSW 8 93127599 missense probably benign 0.00
R7013:Ces1c UTSW 8 93130764 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATAGTCCCCATCCCAGTGG -3'
(R):5'- GCGACTTTTATACCTCCAAACAG -3'

Sequencing Primer
(F):5'- CATCCCAGTGGCTTACATAGGAG -3'
(R):5'- GACCCTGTATTTAATGTTGGAAGG -3'
Posted On2019-05-15