Incidental Mutation 'R7137:Arhgap32'
ID553136
Institutional Source Beutler Lab
Gene Symbol Arhgap32
Ensembl Gene ENSMUSG00000041444
Gene NameRho GTPase activating protein 32
Synonymsp200RhoGAP, Grit, GC-GAP, PX-RICS, 3426406O18Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7137 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location32116136-32268446 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 32151936 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 80 (D80E)
Ref Sequence ENSEMBL: ENSMUSP00000133898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000174641]
Predicted Effect probably benign
Transcript: ENSMUST00000174641
AA Change: D80E

PolyPhen 2 Score 0.323 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000133898
Gene: ENSMUSG00000041444
AA Change: D80E

DomainStartEndE-ValueType
Pfam:PX 132 226 5.6e-7 PFAM
SH3 262 320 7.4e-11 SMART
RhoGAP 383 564 9.6e-60 SMART
Blast:RhoGAP 581 647 9e-31 BLAST
low complexity region 867 882 N/A INTRINSIC
low complexity region 1018 1038 N/A INTRINSIC
low complexity region 1045 1059 N/A INTRINSIC
low complexity region 1262 1275 N/A INTRINSIC
low complexity region 1309 1323 N/A INTRINSIC
low complexity region 1346 1357 N/A INTRINSIC
low complexity region 1425 1442 N/A INTRINSIC
low complexity region 1653 1666 N/A INTRINSIC
low complexity region 2040 2049 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RICS is a neuron-associated GTPase-activating protein that may regulate dendritic spine morphology and strength by modulating Rho GTPase (see RHOA; MIM 165390) activity (Okabe et al., 2003 [PubMed 12531901]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null mutation are fertile but display abnormal neurite growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,677,985 S1423P possibly damaging Het
Acvr1c A G 2: 58,283,387 probably null Het
Adgrf5 A G 17: 43,450,897 K1161R probably damaging Het
Aspg T C 12: 112,112,198 V30A possibly damaging Het
Bcl2a1d T C 9: 88,731,478 D81G probably damaging Het
Cep170b T C 12: 112,735,167 V160A probably benign Het
Ces1c T C 8: 93,130,842 Y37C probably benign Het
Cntnap5a T C 1: 116,089,376 L233P probably damaging Het
Crem C A 18: 3,273,459 A245S possibly damaging Het
Cyp2d12 C T 15: 82,557,821 A280V probably benign Het
Dnah2 C T 11: 69,491,555 G1243D probably damaging Het
Emcn T G 3: 137,403,991 N131K probably damaging Het
Fat3 A T 9: 15,997,148 D2519E probably damaging Het
Fibin T A 2: 110,362,656 D47V probably damaging Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
Gimap8 C A 6: 48,650,253 L54I probably damaging Het
Gm20481 A G 17: 34,970,095 Y27C unknown Het
Gm21319 A T 12: 87,773,546 L81Q possibly damaging Het
Grin1 T G 2: 25,313,538 M154L probably benign Het
Ighv8-13 A G 12: 115,765,577 L20P probably damaging Het
Insc G A 7: 114,811,615 V236I probably benign Het
Lrrk1 A G 7: 66,285,279 F1031L probably benign Het
Man2a2 C A 7: 80,359,751 R785L probably benign Het
Mcur1 C A 13: 43,544,455 probably null Het
Med12l A C 3: 59,258,254 R1464S probably damaging Het
Mycbp2 A T 14: 103,282,679 M767K possibly damaging Het
Naalad2 T C 9: 18,323,487 I762V probably benign Het
Nfkbid A G 7: 30,426,256 T357A possibly damaging Het
Pcdh17 A G 14: 84,533,549 R1156G possibly damaging Het
Pcdhb1 T C 18: 37,267,392 S799P possibly damaging Het
Pde3a A T 6: 141,498,746 E1093D probably benign Het
Plcg1 T C 2: 160,753,926 Y572H possibly damaging Het
Plxna4 A G 6: 32,517,264 L139P probably damaging Het
Psma1 A G 7: 114,274,448 Y6H probably damaging Het
Psmd2 A G 16: 20,652,627 E76G probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Pyy T G 11: 102,107,273 D27A possibly damaging Het
Slc22a2 A G 17: 12,584,341 T21A probably benign Het
Slc25a2 T C 18: 37,638,147 I110V probably benign Het
Sult1c2 A C 17: 53,838,394 W85G probably damaging Het
Svs1 A G 6: 48,990,149 Y677C probably damaging Het
Syt12 C T 19: 4,453,950 D218N probably damaging Het
Tln1 C T 4: 43,540,616 V1462M probably damaging Het
Tor1aip2 T A 1: 156,051,976 N33K possibly damaging Het
Usp17lb C A 7: 104,841,591 W43L probably benign Het
Vmn1r76 A G 7: 11,930,685 Y201H possibly damaging Het
Wnk1 C A 6: 120,038,212 probably benign Het
Wrnip1 A G 13: 32,802,749 D171G probably benign Het
Zar1 T A 5: 72,580,816 N81I probably damaging Het
Zbtb45 T C 7: 13,007,156 T392A probably benign Het
Zfp445 T C 9: 122,854,778 E272G probably damaging Het
Other mutations in Arhgap32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Arhgap32 APN 9 32257361 missense probably benign 0.00
IGL01317:Arhgap32 APN 9 32256964 missense probably benign 0.30
IGL01614:Arhgap32 APN 9 32260505 missense probably damaging 1.00
IGL01791:Arhgap32 APN 9 32247190 missense probably damaging 0.96
IGL02318:Arhgap32 APN 9 32259331 missense probably benign 0.00
IGL02542:Arhgap32 APN 9 32255648 missense probably damaging 1.00
IGL02568:Arhgap32 APN 9 32247194 missense probably damaging 1.00
IGL02627:Arhgap32 APN 9 32246006 missense probably damaging 1.00
IGL02927:Arhgap32 APN 9 32261135 missense possibly damaging 0.95
IGL03157:Arhgap32 APN 9 32259134 missense probably damaging 1.00
IGL03286:Arhgap32 APN 9 32259520 missense probably benign 0.06
PIT4445001:Arhgap32 UTSW 9 32260856 missense probably damaging 1.00
R0004:Arhgap32 UTSW 9 32151998 missense probably damaging 0.98
R0335:Arhgap32 UTSW 9 32259760 missense probably benign 0.00
R0380:Arhgap32 UTSW 9 32246477 missense probably damaging 1.00
R0396:Arhgap32 UTSW 9 32245255 critical splice donor site probably null
R0494:Arhgap32 UTSW 9 32258903 missense probably damaging 0.98
R0508:Arhgap32 UTSW 9 32190068 splice site probably benign
R0856:Arhgap32 UTSW 9 32260220 missense probably damaging 1.00
R0990:Arhgap32 UTSW 9 32255381 missense probably damaging 1.00
R1312:Arhgap32 UTSW 9 32255312 missense probably benign
R1455:Arhgap32 UTSW 9 32260085 missense probably benign 0.08
R1515:Arhgap32 UTSW 9 32116202 missense probably benign
R1523:Arhgap32 UTSW 9 32256752 missense probably damaging 1.00
R1651:Arhgap32 UTSW 9 32259800 missense probably damaging 1.00
R1743:Arhgap32 UTSW 9 32259431 missense probably benign 0.00
R1999:Arhgap32 UTSW 9 32116140 missense possibly damaging 0.52
R2098:Arhgap32 UTSW 9 32259911 missense probably damaging 1.00
R2150:Arhgap32 UTSW 9 32116140 missense possibly damaging 0.52
R2256:Arhgap32 UTSW 9 32247497 missense probably damaging 0.99
R2257:Arhgap32 UTSW 9 32247497 missense probably damaging 0.99
R2989:Arhgap32 UTSW 9 32239398 missense possibly damaging 0.54
R3780:Arhgap32 UTSW 9 32152019 splice site probably null
R3793:Arhgap32 UTSW 9 32255373 missense probably damaging 1.00
R3846:Arhgap32 UTSW 9 32190024 missense probably benign 0.03
R4086:Arhgap32 UTSW 9 32247066 unclassified probably benign
R4177:Arhgap32 UTSW 9 32247214 missense probably null 1.00
R4230:Arhgap32 UTSW 9 32257474 missense probably benign 0.10
R4280:Arhgap32 UTSW 9 32259889 missense probably damaging 0.98
R4504:Arhgap32 UTSW 9 32181839 splice site probably null
R4587:Arhgap32 UTSW 9 32260945 missense probably benign 0.02
R4612:Arhgap32 UTSW 9 32259479 missense probably damaging 0.99
R4622:Arhgap32 UTSW 9 32239348 missense possibly damaging 0.75
R4670:Arhgap32 UTSW 9 32170145 missense probably benign 0.03
R4784:Arhgap32 UTSW 9 32129653 missense probably damaging 0.99
R4784:Arhgap32 UTSW 9 32260780 missense probably damaging 1.00
R4785:Arhgap32 UTSW 9 32129653 missense probably damaging 0.99
R4785:Arhgap32 UTSW 9 32260780 missense probably damaging 1.00
R4906:Arhgap32 UTSW 9 32245256 critical splice donor site probably null
R5046:Arhgap32 UTSW 9 32256799 missense probably damaging 1.00
R5360:Arhgap32 UTSW 9 32259671 missense probably damaging 1.00
R5382:Arhgap32 UTSW 9 32152010 missense probably damaging 1.00
R5445:Arhgap32 UTSW 9 32248382 missense probably benign 0.19
R5637:Arhgap32 UTSW 9 32247206 missense probably damaging 1.00
R5659:Arhgap32 UTSW 9 32181960 missense probably damaging 1.00
R5801:Arhgap32 UTSW 9 32255788 missense probably benign 0.01
R6002:Arhgap32 UTSW 9 32256979 missense probably benign 0.00
R6109:Arhgap32 UTSW 9 32260111 missense probably damaging 1.00
R6405:Arhgap32 UTSW 9 32248488 missense probably benign 0.31
R6922:Arhgap32 UTSW 9 32152687 missense possibly damaging 0.86
R7009:Arhgap32 UTSW 9 32245976 missense probably damaging 1.00
R7183:Arhgap32 UTSW 9 32186383 missense probably benign 0.15
R7251:Arhgap32 UTSW 9 32208185 missense probably damaging 1.00
R7287:Arhgap32 UTSW 9 32152697 missense
R7289:Arhgap32 UTSW 9 32256937 missense possibly damaging 0.92
R7289:Arhgap32 UTSW 9 32256938 missense probably benign 0.02
X0027:Arhgap32 UTSW 9 32250641 critical splice acceptor site probably null
X0063:Arhgap32 UTSW 9 32261069 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATTGCTAGTGGTCAAGTAAGTTC -3'
(R):5'- TGAGTTGCATATAGACCTGTTCAG -3'

Sequencing Primer
(F):5'- CGAGTGAAAATGTATCTGTAGTC -3'
(R):5'- GCATATAGACCTGTTCAGTTCATTG -3'
Posted On2019-05-15