Incidental Mutation 'R7137:Zfp445'
ID553138
Institutional Source Beutler Lab
Gene Symbol Zfp445
Ensembl Gene ENSMUSG00000047036
Gene Namezinc finger protein 445
SynonymsZNF168
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.637) question?
Stock #R7137 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location122844529-122866006 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122854778 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 272 (E272G)
Ref Sequence ENSEMBL: ENSMUSP00000055738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056467] [ENSMUST00000213971] [ENSMUST00000214626] [ENSMUST00000216063]
Predicted Effect probably damaging
Transcript: ENSMUST00000056467
AA Change: E272G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000055738
Gene: ENSMUSG00000047036
AA Change: E272G

DomainStartEndE-ValueType
SCAN 48 160 1.07e-59 SMART
KRAB 219 278 6.74e-30 SMART
low complexity region 320 334 N/A INTRINSIC
low complexity region 419 430 N/A INTRINSIC
ZnF_C2H2 470 492 2.09e-3 SMART
ZnF_C2H2 498 520 3.16e-3 SMART
ZnF_C2H2 553 575 1.41e0 SMART
ZnF_C2H2 581 603 1.04e-3 SMART
ZnF_C2H2 634 656 1.6e-4 SMART
ZnF_C2H2 662 686 6.78e-3 SMART
ZnF_C2H2 718 740 1.67e-2 SMART
ZnF_C2H2 746 768 1.2e-3 SMART
ZnF_C2H2 796 818 2.02e-1 SMART
ZnF_C2H2 824 846 2.95e-3 SMART
ZnF_C2H2 933 955 2.49e-1 SMART
ZnF_C2H2 961 983 4.61e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000213971
AA Change: E98G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000214626
AA Change: E272G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216063
AA Change: E272G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,677,985 S1423P possibly damaging Het
Acvr1c A G 2: 58,283,387 probably null Het
Adgrf5 A G 17: 43,450,897 K1161R probably damaging Het
Arhgap32 T G 9: 32,151,936 D80E probably benign Het
Aspg T C 12: 112,112,198 V30A possibly damaging Het
Bcl2a1d T C 9: 88,731,478 D81G probably damaging Het
Cep170b T C 12: 112,735,167 V160A probably benign Het
Ces1c T C 8: 93,130,842 Y37C probably benign Het
Cntnap5a T C 1: 116,089,376 L233P probably damaging Het
Crem C A 18: 3,273,459 A245S possibly damaging Het
Cyp2d12 C T 15: 82,557,821 A280V probably benign Het
Dnah2 C T 11: 69,491,555 G1243D probably damaging Het
Emcn T G 3: 137,403,991 N131K probably damaging Het
Fat3 A T 9: 15,997,148 D2519E probably damaging Het
Fibin T A 2: 110,362,656 D47V probably damaging Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
Gimap8 C A 6: 48,650,253 L54I probably damaging Het
Gm20481 A G 17: 34,970,095 Y27C unknown Het
Gm21319 A T 12: 87,773,546 L81Q possibly damaging Het
Grin1 T G 2: 25,313,538 M154L probably benign Het
Ighv8-13 A G 12: 115,765,577 L20P probably damaging Het
Insc G A 7: 114,811,615 V236I probably benign Het
Lrrk1 A G 7: 66,285,279 F1031L probably benign Het
Man2a2 C A 7: 80,359,751 R785L probably benign Het
Mcur1 C A 13: 43,544,455 probably null Het
Med12l A C 3: 59,258,254 R1464S probably damaging Het
Mycbp2 A T 14: 103,282,679 M767K possibly damaging Het
Naalad2 T C 9: 18,323,487 I762V probably benign Het
Nfkbid A G 7: 30,426,256 T357A possibly damaging Het
Pcdh17 A G 14: 84,533,549 R1156G possibly damaging Het
Pcdhb1 T C 18: 37,267,392 S799P possibly damaging Het
Pde3a A T 6: 141,498,746 E1093D probably benign Het
Plcg1 T C 2: 160,753,926 Y572H possibly damaging Het
Plxna4 A G 6: 32,517,264 L139P probably damaging Het
Psma1 A G 7: 114,274,448 Y6H probably damaging Het
Psmd2 A G 16: 20,652,627 E76G probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Pyy T G 11: 102,107,273 D27A possibly damaging Het
Slc22a2 A G 17: 12,584,341 T21A probably benign Het
Slc25a2 T C 18: 37,638,147 I110V probably benign Het
Sult1c2 A C 17: 53,838,394 W85G probably damaging Het
Svs1 A G 6: 48,990,149 Y677C probably damaging Het
Syt12 C T 19: 4,453,950 D218N probably damaging Het
Tln1 C T 4: 43,540,616 V1462M probably damaging Het
Tor1aip2 T A 1: 156,051,976 N33K possibly damaging Het
Usp17lb C A 7: 104,841,591 W43L probably benign Het
Vmn1r76 A G 7: 11,930,685 Y201H possibly damaging Het
Wnk1 C A 6: 120,038,212 probably benign Het
Wrnip1 A G 13: 32,802,749 D171G probably benign Het
Zar1 T A 5: 72,580,816 N81I probably damaging Het
Zbtb45 T C 7: 13,007,156 T392A probably benign Het
Other mutations in Zfp445
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02427:Zfp445 APN 9 122852230 missense probably benign 0.02
IGL02608:Zfp445 APN 9 122861875 missense probably damaging 0.98
IGL03216:Zfp445 APN 9 122851978 missense probably damaging 0.99
IGL03218:Zfp445 APN 9 122857529 missense probably benign 0.00
Nonpareil UTSW 9 122852345 missense probably benign 0.02
R0080:Zfp445 UTSW 9 122852356 missense probably damaging 0.98
R0082:Zfp445 UTSW 9 122852356 missense probably damaging 0.98
R0453:Zfp445 UTSW 9 122853513 missense possibly damaging 0.92
R0610:Zfp445 UTSW 9 122852981 missense probably benign 0.44
R0730:Zfp445 UTSW 9 122861758 missense probably damaging 1.00
R1622:Zfp445 UTSW 9 122852549 missense possibly damaging 0.90
R1719:Zfp445 UTSW 9 122852642 missense probably damaging 1.00
R2108:Zfp445 UTSW 9 122852240 missense probably benign 0.13
R2117:Zfp445 UTSW 9 122853437 nonsense probably null
R2143:Zfp445 UTSW 9 122853482 missense possibly damaging 0.70
R2162:Zfp445 UTSW 9 122852476 missense probably damaging 0.99
R3620:Zfp445 UTSW 9 122852768 missense probably benign
R3621:Zfp445 UTSW 9 122852768 missense probably benign
R3745:Zfp445 UTSW 9 122854726 missense probably benign 0.00
R3829:Zfp445 UTSW 9 122853077 missense probably benign
R3831:Zfp445 UTSW 9 122852476 missense probably damaging 0.99
R4172:Zfp445 UTSW 9 122851937 missense probably benign 0.01
R4180:Zfp445 UTSW 9 122852524 missense probably benign 0.00
R4747:Zfp445 UTSW 9 122857150 missense possibly damaging 0.81
R4923:Zfp445 UTSW 9 122852293 missense probably benign
R5010:Zfp445 UTSW 9 122852345 missense probably benign 0.02
R5578:Zfp445 UTSW 9 122853337 missense probably benign 0.00
R5759:Zfp445 UTSW 9 122853146 missense probably benign 0.00
R5864:Zfp445 UTSW 9 122853487 missense probably benign 0.00
R5865:Zfp445 UTSW 9 122853487 missense probably benign 0.00
R5987:Zfp445 UTSW 9 122853886 missense probably benign
R6481:Zfp445 UTSW 9 122857566 missense probably benign 0.00
R6738:Zfp445 UTSW 9 122862058 missense probably damaging 0.96
R6917:Zfp445 UTSW 9 122862294 intron probably null
R7224:Zfp445 UTSW 9 122852143 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- AGAAAGTGGCCCAGGGTTCTAG -3'
(R):5'- TCTTAGGGCTATCACAAATGGCTG -3'

Sequencing Primer
(F):5'- GGTTCTAGCACCCCTTAGTAAG -3'
(R):5'- GGCCAGGCATTCTGTCCTAG -3'
Posted On2019-05-15