Incidental Mutation 'R7139:Zfp39'
ID553287
Institutional Source Beutler Lab
Gene Symbol Zfp39
Ensembl Gene ENSMUSG00000037001
Gene Namezinc finger protein 39
SynonymsZfp-39, CTfin33
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.390) question?
Stock #R7139 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location58888153-58904225 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58890559 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 459 (H459R)
Ref Sequence ENSEMBL: ENSMUSP00000099764 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102703]
Predicted Effect probably damaging
Transcript: ENSMUST00000102703
AA Change: H459R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099764
Gene: ENSMUSG00000037001
AA Change: H459R

DomainStartEndE-ValueType
KRAB 59 119 8.23e-34 SMART
low complexity region 171 180 N/A INTRINSIC
ZnF_C2H2 298 320 9.58e-3 SMART
ZnF_C2H2 326 347 2.2e2 SMART
ZnF_C2H2 353 373 1.18e2 SMART
ZnF_C2H2 409 431 8.34e-3 SMART
ZnF_C2H2 437 459 7.26e-3 SMART
ZnF_C2H2 465 487 1.53e-1 SMART
ZnF_C2H2 493 515 9.08e-4 SMART
ZnF_C2H2 521 543 2.61e-4 SMART
ZnF_C2H2 549 571 1.12e-3 SMART
ZnF_C2H2 577 599 4.94e-5 SMART
ZnF_C2H2 605 627 5.14e-3 SMART
ZnF_C2H2 633 655 1.38e-3 SMART
ZnF_C2H2 661 683 6.78e-3 SMART
ZnF_C2H2 689 711 5.14e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Kruppel-associated box (KRAB) zinc-finger protein, which belongs to a large group of transcriptional regulators in mammals. These proteins bind nucleic acids and play important roles in various cellular functions, including cell proliferation, differentiation and apoptosis, and in regulating viral replication and transcription. A pseudogene of this gene was identified on chromosome 1. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik A G 4: 147,941,838 R272G possibly damaging Het
4930512M02Rik T A 11: 11,590,078 N179Y unknown Het
4930562C15Rik A T 16: 4,850,184 M480L probably benign Het
Abcd4 A G 12: 84,606,298 C377R probably benign Het
Adam23 C A 1: 63,545,577 D381E probably damaging Het
Angpt1 T A 15: 42,676,351 Q37H probably damaging Het
Apeh A T 9: 108,092,146 F260I probably damaging Het
Cadps2 T C 6: 23,410,889 Y681C probably damaging Het
Ccdc162 T C 10: 41,666,721 M386V possibly damaging Het
Celsr2 T C 3: 108,415,359 S46G unknown Het
Cfc1 T C 1: 34,536,479 L78P probably benign Het
Chd7 T C 4: 8,865,865 V2724A probably benign Het
Clca3a1 A T 3: 144,755,302 V196E possibly damaging Het
Cma1 T C 14: 55,943,816 H44R probably damaging Het
Cnot2 T C 10: 116,495,019 N394S probably benign Het
Cstf3 A T 2: 104,653,064 I372F possibly damaging Het
Cyb5rl A C 4: 107,071,011 I115L probably benign Het
D5Ertd579e A G 5: 36,613,976 L1025P probably damaging Het
Dmtn T C 14: 70,617,427 N36S probably benign Het
Dnah6 A G 6: 73,135,680 V1647A probably damaging Het
Dock6 T C 9: 21,801,276 Y2063C probably damaging Het
Dst T A 1: 34,299,807 D5149E probably damaging Het
Fancl A G 11: 26,403,358 M85V probably benign Het
Fgd2 T A 17: 29,373,255 F387Y probably damaging Het
Fshr A T 17: 88,986,161 I363N possibly damaging Het
Glce G T 9: 62,070,434 S56* probably null Het
Gm26727 A T 2: 67,433,037 S49T unknown Het
Gm36210 T A 7: 4,899,278 D131V probably damaging Het
Gm5089 T C 14: 122,435,991 D106G unknown Het
Gm5622 G T 14: 51,655,882 E89* probably null Het
Gm9573 TCCTGAGGCAGTGCTGGATACAGGGGTGGTTGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGAT TCCTGAGGCAGTGCTGGAT 17: 35,622,633 probably benign Het
H2afy2 T A 10: 61,757,895 M1L unknown Het
H2-Eb2 C T 17: 34,334,421 R194W probably benign Het
Hivep1 A T 13: 42,159,954 E1890V probably benign Het
Ighv1-53 A T 12: 115,158,821 C5* probably null Het
Ighv2-5 T A 12: 113,685,599 Y78F probably benign Het
Il9 C T 13: 56,480,613 V88I probably benign Het
Kidins220 A G 12: 24,994,821 T163A probably damaging Het
Lama4 G T 10: 39,075,495 D1079Y probably damaging Het
Lman1l A T 9: 57,615,596 H160Q probably benign Het
Lrrc34 T C 3: 30,624,887 I354V probably benign Het
Mpeg1 A T 19: 12,461,714 T179S probably benign Het
Mrgpra2a A T 7: 47,426,589 L307H probably damaging Het
Mst1 G A 9: 108,082,828 R328H probably damaging Het
Nav3 C A 10: 109,853,477 S313I probably benign Het
Nmt2 T G 2: 3,284,315 S7A probably benign Het
Nsmce1 T C 7: 125,469,082 S197G probably benign Het
Ociad2 A G 5: 73,335,875 V4A probably benign Het
Olfr680-ps1 G T 7: 105,092,798 T7K probably benign Het
Osmr T C 15: 6,821,088 D679G possibly damaging Het
Pappa T A 4: 65,189,450 F699L probably benign Het
Parp8 T A 13: 117,025,266 M40L probably benign Het
Pcyox1 A T 6: 86,394,537 N122K possibly damaging Het
Pkd1l1 T C 11: 8,890,737 S1224G Het
Pkd1l3 T A 8: 109,636,340 S1088T probably damaging Het
Prrt1 T C 17: 34,631,077 V155A probably benign Het
Rbm6 A C 9: 107,853,211 D79E probably damaging Het
Sec31b A T 19: 44,518,936 S819T probably benign Het
Slc22a27 A T 19: 7,926,547 I75N probably damaging Het
Slc25a54 G A 3: 109,098,589 G138R probably damaging Het
Slc6a12 T C 6: 121,365,319 S612P probably benign Het
Slc7a2 A T 8: 40,915,013 I605F probably benign Het
Slit2 A G 5: 48,244,683 T805A probably benign Het
Strbp A T 2: 37,624,502 H308Q probably benign Het
Stxbp4 G A 11: 90,607,009 Q155* probably null Het
Sybu A T 15: 44,677,714 N317K possibly damaging Het
Taok1 G A 11: 77,571,633 S210F probably damaging Het
Tapbp A G 17: 33,920,048 D72G possibly damaging Het
Thbd G T 2: 148,406,541 T469K probably benign Het
Tia1 T C 6: 86,427,688 Y302H possibly damaging Het
Tlr4 T C 4: 66,840,283 F438L probably benign Het
Tmem235 C T 11: 117,860,897 S49L probably damaging Het
Trip4 A G 9: 65,885,221 probably benign Het
Trrap C A 5: 144,803,178 L1137I possibly damaging Het
Vmo1 T C 11: 70,513,848 E109G probably benign Het
Wdfy4 T C 14: 33,151,578 Y258C Het
Wdr91 T G 6: 34,908,263 N121T possibly damaging Het
Zfp936 T A 7: 43,190,291 I394K possibly damaging Het
Zpr1 G A 9: 46,281,059 D423N probably damaging Het
Other mutations in Zfp39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Zfp39 APN 11 58893059 splice site probably benign
IGL01597:Zfp39 APN 11 58891543 missense probably damaging 0.96
IGL02055:Zfp39 APN 11 58891330 missense probably benign
IGL02456:Zfp39 APN 11 58902800 nonsense probably null
IGL02873:Zfp39 APN 11 58891022 missense probably benign 0.12
H8562:Zfp39 UTSW 11 58900686 missense probably damaging 1.00
R0462:Zfp39 UTSW 11 58890406 missense probably benign 0.03
R0513:Zfp39 UTSW 11 58889987 missense probably benign 0.09
R1185:Zfp39 UTSW 11 58902844 missense possibly damaging 0.91
R1185:Zfp39 UTSW 11 58902844 missense possibly damaging 0.91
R1185:Zfp39 UTSW 11 58902844 missense possibly damaging 0.91
R1401:Zfp39 UTSW 11 58890323 missense probably benign 0.01
R1797:Zfp39 UTSW 11 58900660 missense probably damaging 0.96
R2146:Zfp39 UTSW 11 58890332 missense probably benign 0.05
R3903:Zfp39 UTSW 11 58890175 missense probably benign 0.44
R4303:Zfp39 UTSW 11 58890017 missense probably damaging 1.00
R4706:Zfp39 UTSW 11 58902807 missense probably benign 0.41
R4957:Zfp39 UTSW 11 58891231 missense possibly damaging 0.63
R5092:Zfp39 UTSW 11 58891202 missense possibly damaging 0.71
R5158:Zfp39 UTSW 11 58889845 missense possibly damaging 0.81
R5292:Zfp39 UTSW 11 58900589 missense probably damaging 0.97
R5697:Zfp39 UTSW 11 58889835 missense probably benign 0.08
R5906:Zfp39 UTSW 11 58902891 missense probably benign
R5925:Zfp39 UTSW 11 58891273 missense possibly damaging 0.94
R6174:Zfp39 UTSW 11 58891387 missense probably benign 0.01
R6177:Zfp39 UTSW 11 58891061 missense probably benign 0.27
R6968:Zfp39 UTSW 11 58891480 missense probably benign 0.00
R7045:Zfp39 UTSW 11 58890443 missense unknown
Predicted Primers PCR Primer
(F):5'- GAGGACTTATGGAGGAAGGTTTTC -3'
(R):5'- CGTGCCGGTTATAAGCCCTA -3'

Sequencing Primer
(F):5'- GACTGCCGGTGAAAAGTTTTCCC -3'
(R):5'- AAGCCCTATGGATGTAACCTGTG -3'
Posted On2019-05-15