Incidental Mutation 'R7142:Cd93'
ID553451
Institutional Source Beutler Lab
Gene Symbol Cd93
Ensembl Gene ENSMUSG00000027435
Gene NameCD93 antigen
SynonymsC1qrp, AA4.1, Ly68, 6030404G09Rik, C1qr1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R7142 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location148436640-148443563 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 148441805 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 540 (W540*)
Ref Sequence ENSEMBL: ENSMUSP00000096876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099269]
Predicted Effect probably null
Transcript: ENSMUST00000099269
AA Change: W540*
SMART Domains Protein: ENSMUSP00000096876
Gene: ENSMUSG00000027435
AA Change: W540*

DomainStartEndE-ValueType
CLECT 23 180 5.04e-7 SMART
EGF 260 298 2.56e-3 SMART
EGF 302 341 3.73e-5 SMART
EGF_CA 342 381 1.33e-10 SMART
EGF_CA 382 423 4.38e-11 SMART
EGF_CA 424 465 1.33e-10 SMART
low complexity region 488 501 N/A INTRINSIC
transmembrane domain 576 598 N/A INTRINSIC
low complexity region 604 612 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cell-surface glycoprotein and type I membrane protein that was originally identified as a myeloid cell-specific marker. The encoded protein was once thought to be a receptor for C1q, but now is thought to instead be involved in intercellular adhesion and in the clearance of apoptotic cells. The intracellular cytoplasmic tail of this protein has been found to interact with moesin, a protein known to play a role in linking transmembrane proteins to the cytoskeleton and in the remodelling of the cytoskeleton. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have a defect in clearance of apoptotic cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T A 10: 79,067,612 H290L probably damaging Het
Abca1 T A 4: 53,082,050 S737C probably damaging Het
Abca14 G C 7: 120,251,183 V753L possibly damaging Het
Adgrl1 C T 8: 83,937,200 H1099Y probably benign Het
Akap6 T G 12: 52,887,364 D546E probably benign Het
Aldh1l1 G A 6: 90,563,416 D228N probably damaging Het
Cacna1e G T 1: 154,412,484 Q1883K probably damaging Het
Caskin2 A G 11: 115,806,736 Y125H probably benign Het
Ccdc85a A T 11: 28,577,192 Y139N probably damaging Het
Cdh3 G A 8: 106,545,228 probably null Het
Chmp2b G A 16: 65,546,908 Q88* probably null Het
Cpt1a T C 19: 3,375,100 M489T probably benign Het
Ctsk G A 3: 95,506,948 V274M possibly damaging Het
Cyp3a44 A G 5: 145,777,961 V460A probably benign Het
Cypt4 C T 9: 24,625,444 R77* probably null Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dnah7a A T 1: 53,413,768 Y3850* probably null Het
Drosha A T 15: 12,924,146 T1205S possibly damaging Het
Eif3j2 T C 18: 43,477,400 E116G probably damaging Het
Ercc5 A G 1: 44,174,214 E790G probably damaging Het
Fam163b C T 2: 27,113,555 R29Q probably damaging Het
Fbxo44 C T 4: 148,158,812 G50E unknown Het
Gm9992 G A 17: 7,376,622 T96I probably damaging Het
Gnal C T 18: 67,218,528 P386L probably damaging Het
Gpc5 T A 14: 115,417,203 H478Q probably benign Het
Grhl2 A T 15: 37,279,582 D178V probably benign Het
Gtf2i C A 5: 134,244,851 V755L possibly damaging Het
Hal T C 10: 93,500,651 V414A possibly damaging Het
Hmx2 T C 7: 131,555,736 V193A probably damaging Het
Il17a T A 1: 20,732,103 M12K probably benign Het
Invs T A 4: 48,407,696 I557N probably damaging Het
Kng1 T A 16: 23,079,420 H523Q probably benign Het
Lrp4 T A 2: 91,494,994 I1388N probably damaging Het
Mboat4 A G 8: 34,120,137 I63V probably benign Het
Mcoln2 G A 3: 146,183,569 probably null Het
Mgat5 A T 1: 127,412,187 D435V probably damaging Het
Mri1 C A 8: 84,257,124 R46L probably damaging Het
Mxra8 A T 4: 155,843,062 Y409F probably benign Het
Nlrp1b T A 11: 71,172,075 R720* probably null Het
Ofcc1 T C 13: 40,004,062 I887V probably benign Het
Olfr1156 T C 2: 87,949,712 I174V probably benign Het
P3h1 T A 4: 119,247,161 D626E probably benign Het
Pde2a A T 7: 101,504,650 D485V probably damaging Het
Phldb2 G A 16: 45,757,176 R1129* probably null Het
Pkn1 T C 8: 83,693,967 E10G possibly damaging Het
Psd2 A G 18: 35,980,044 D264G possibly damaging Het
Psg29 A G 7: 17,210,621 D352G probably damaging Het
Rgs14 T C 13: 55,379,604 S218P probably damaging Het
Sec14l2 T C 11: 4,098,379 T380A probably benign Het
Sept12 T C 16: 4,988,362 T312A unknown Het
Skint5 A T 4: 113,571,594 V1075E unknown Het
Ston2 A G 12: 91,647,235 S800P probably damaging Het
Tmem106b A G 6: 13,081,565 N157S probably damaging Het
Tmem132b G A 5: 125,622,673 G133S probably damaging Het
Tmie A T 9: 110,870,681 M55K possibly damaging Het
Trpc6 A T 9: 8,653,016 R608* probably null Het
Usp35 A G 7: 97,311,547 S891P probably damaging Het
Vmn1r178 A G 7: 23,893,610 T28A probably damaging Het
Wnk1 T A 6: 119,949,279 M1324L probably benign Het
Wrnip1 C A 13: 32,802,633 S132R possibly damaging Het
Wsb1 T C 11: 79,250,988 K68E probably benign Het
Zfp433 A T 10: 81,720,206 K181* probably null Het
Other mutations in Cd93
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0076:Cd93 UTSW 2 148442136 missense probably benign
R0379:Cd93 UTSW 2 148441510 splice site probably benign
R1951:Cd93 UTSW 2 148441858 missense probably benign 0.01
R2399:Cd93 UTSW 2 148442151 missense probably benign 0.37
R4231:Cd93 UTSW 2 148442960 missense probably benign 0.02
R4830:Cd93 UTSW 2 148443379 nonsense probably null
R5940:Cd93 UTSW 2 148442232 missense probably benign 0.25
R6057:Cd93 UTSW 2 148441519 missense probably damaging 1.00
R6797:Cd93 UTSW 2 148442124 missense probably benign 0.00
R7184:Cd93 UTSW 2 148442539 missense possibly damaging 0.76
R7276:Cd93 UTSW 2 148441740 missense probably damaging 0.98
R7315:Cd93 UTSW 2 148442541 missense probably damaging 1.00
Z1088:Cd93 UTSW 2 148442364 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- ATGAGAATCCCTAGGGCCAG -3'
(R):5'- TCTTTTGTAGCAGGGGCAC -3'

Sequencing Primer
(F):5'- GCCAGCACCAGCAAGAGTG -3'
(R):5'- GTGTTTTCTGAACTACCAGCCAGG -3'
Posted On2019-05-15