Incidental Mutation 'R7142:Psg29'
ID553467
Institutional Source Beutler Lab
Gene Symbol Psg29
Ensembl Gene ENSMUSG00000023159
Gene Namepregnancy-specific glycoprotein 29
Synonymscea17
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.040) question?
Stock #R7142 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location17203477-17215760 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 17210621 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 352 (D352G)
Ref Sequence ENSEMBL: ENSMUSP00000075320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075934]
Predicted Effect probably damaging
Transcript: ENSMUST00000075934
AA Change: D352G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075320
Gene: ENSMUSG00000023159
AA Change: D352G

DomainStartEndE-ValueType
IG 40 137 7.77e-1 SMART
IG 156 257 8.72e-4 SMART
IG 276 377 2.44e0 SMART
IGc2 393 457 3.06e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T A 10: 79,067,612 H290L probably damaging Het
Abca1 T A 4: 53,082,050 S737C probably damaging Het
Abca14 G C 7: 120,251,183 V753L possibly damaging Het
Adgrl1 C T 8: 83,937,200 H1099Y probably benign Het
Akap6 T G 12: 52,887,364 D546E probably benign Het
Aldh1l1 G A 6: 90,563,416 D228N probably damaging Het
Cacna1e G T 1: 154,412,484 Q1883K probably damaging Het
Caskin2 A G 11: 115,806,736 Y125H probably benign Het
Ccdc85a A T 11: 28,577,192 Y139N probably damaging Het
Cd93 C T 2: 148,441,805 W540* probably null Het
Cdh3 G A 8: 106,545,228 probably null Het
Chmp2b G A 16: 65,546,908 Q88* probably null Het
Cpt1a T C 19: 3,375,100 M489T probably benign Het
Ctsk G A 3: 95,506,948 V274M possibly damaging Het
Cyp3a44 A G 5: 145,777,961 V460A probably benign Het
Cypt4 C T 9: 24,625,444 R77* probably null Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dnah7a A T 1: 53,413,768 Y3850* probably null Het
Drosha A T 15: 12,924,146 T1205S possibly damaging Het
Eif3j2 T C 18: 43,477,400 E116G probably damaging Het
Ercc5 A G 1: 44,174,214 E790G probably damaging Het
Fam163b C T 2: 27,113,555 R29Q probably damaging Het
Fbxo44 C T 4: 148,158,812 G50E unknown Het
Gm9992 G A 17: 7,376,622 T96I probably damaging Het
Gnal C T 18: 67,218,528 P386L probably damaging Het
Gpc5 T A 14: 115,417,203 H478Q probably benign Het
Grhl2 A T 15: 37,279,582 D178V probably benign Het
Gtf2i C A 5: 134,244,851 V755L possibly damaging Het
Hal T C 10: 93,500,651 V414A possibly damaging Het
Hmx2 T C 7: 131,555,736 V193A probably damaging Het
Il17a T A 1: 20,732,103 M12K probably benign Het
Invs T A 4: 48,407,696 I557N probably damaging Het
Kng1 T A 16: 23,079,420 H523Q probably benign Het
Lrp4 T A 2: 91,494,994 I1388N probably damaging Het
Mboat4 A G 8: 34,120,137 I63V probably benign Het
Mcoln2 G A 3: 146,183,569 probably null Het
Mgat5 A T 1: 127,412,187 D435V probably damaging Het
Mri1 C A 8: 84,257,124 R46L probably damaging Het
Mxra8 A T 4: 155,843,062 Y409F probably benign Het
Nlrp1b T A 11: 71,172,075 R720* probably null Het
Ofcc1 T C 13: 40,004,062 I887V probably benign Het
Olfr1156 T C 2: 87,949,712 I174V probably benign Het
P3h1 T A 4: 119,247,161 D626E probably benign Het
Pde2a A T 7: 101,504,650 D485V probably damaging Het
Phldb2 G A 16: 45,757,176 R1129* probably null Het
Pkn1 T C 8: 83,693,967 E10G possibly damaging Het
Psd2 A G 18: 35,980,044 D264G possibly damaging Het
Rgs14 T C 13: 55,379,604 S218P probably damaging Het
Sec14l2 T C 11: 4,098,379 T380A probably benign Het
Sept12 T C 16: 4,988,362 T312A unknown Het
Skint5 A T 4: 113,571,594 V1075E unknown Het
Ston2 A G 12: 91,647,235 S800P probably damaging Het
Tmem106b A G 6: 13,081,565 N157S probably damaging Het
Tmem132b G A 5: 125,622,673 G133S probably damaging Het
Tmie A T 9: 110,870,681 M55K possibly damaging Het
Trpc6 A T 9: 8,653,016 R608* probably null Het
Usp35 A G 7: 97,311,547 S891P probably damaging Het
Vmn1r178 A G 7: 23,893,610 T28A probably damaging Het
Wnk1 T A 6: 119,949,279 M1324L probably benign Het
Wrnip1 C A 13: 32,802,633 S132R possibly damaging Het
Wsb1 T C 11: 79,250,988 K68E probably benign Het
Zfp433 A T 10: 81,720,206 K181* probably null Het
Other mutations in Psg29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Psg29 APN 7 17208732 missense probably benign 0.42
IGL01107:Psg29 APN 7 17204925 missense probably benign 0.01
IGL01348:Psg29 APN 7 17210673 missense probably benign 0.09
IGL01353:Psg29 APN 7 17205013 missense possibly damaging 0.54
IGL02546:Psg29 APN 7 17208782 missense probably damaging 1.00
IGL02611:Psg29 APN 7 17208791 missense probably benign 0.15
IGL02982:Psg29 APN 7 17211707 missense probably damaging 0.98
IGL03072:Psg29 APN 7 17208794 missense probably benign 0.06
R1744:Psg29 UTSW 7 17210353 missense probably damaging 1.00
R2272:Psg29 UTSW 7 17210696 missense probably benign 0.19
R3054:Psg29 UTSW 7 17208802 missense probably benign 0.29
R3790:Psg29 UTSW 7 17205025 missense possibly damaging 0.71
R3963:Psg29 UTSW 7 17208585 missense probably benign 0.01
R4464:Psg29 UTSW 7 17210650 missense possibly damaging 0.61
R4740:Psg29 UTSW 7 17208533 missense probably benign 0.00
R4774:Psg29 UTSW 7 17210535 missense probably benign 0.23
R4902:Psg29 UTSW 7 17211912 makesense probably null
R4977:Psg29 UTSW 7 17208631 missense probably damaging 1.00
R5071:Psg29 UTSW 7 17211838 missense probably damaging 1.00
R5072:Psg29 UTSW 7 17211838 missense probably damaging 1.00
R5074:Psg29 UTSW 7 17211838 missense probably damaging 1.00
R5169:Psg29 UTSW 7 17211653 missense probably damaging 1.00
R5415:Psg29 UTSW 7 17211636 splice site probably null
R5729:Psg29 UTSW 7 17210534 missense probably damaging 0.98
R6023:Psg29 UTSW 7 17210512 missense possibly damaging 0.82
R6127:Psg29 UTSW 7 17211746 missense probably benign 0.00
R6900:Psg29 UTSW 7 17204932 nonsense probably null
R7297:Psg29 UTSW 7 17210691 nonsense probably null
X0017:Psg29 UTSW 7 17210661 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCTGAAGGGGAAAGTGTTC -3'
(R):5'- CAGTAAGTAGATGCAATGCAGC -3'

Sequencing Primer
(F):5'- AAGGGGAAAGTGTTCTTCTCCTC -3'
(R):5'- TGCAATGCAGCAGGGGAG -3'
Posted On2019-05-15