Incidental Mutation 'R0600:Myom1'
ID55349
Institutional Source Beutler Lab
Gene Symbol Myom1
Ensembl Gene ENSMUSG00000024049
Gene Namemyomesin 1
Synonymsskelemin, D430047A17Rik
MMRRC Submission 038789-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock #R0600 (G1)
Quality Score163
Status Validated
Chromosome17
Chromosomal Location71019521-71126856 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 71120648 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 1435 (F1435L)
Ref Sequence ENSEMBL: ENSMUSP00000024847 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024847] [ENSMUST00000073211] [ENSMUST00000179759]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024847
AA Change: F1435L

PolyPhen 2 Score 0.483 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000024847
Gene: ENSMUSG00000024049
AA Change: F1435L

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
FN3 818 904 4.99e-11 SMART
FN3 923 1008 2.04e-16 SMART
IG 1025 1110 3.1e0 SMART
IG_like 1133 1219 1.34e1 SMART
IG_like 1253 1319 4.79e0 SMART
IG_like 1356 1433 1.54e2 SMART
IGc2 1469 1537 2.05e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000073211
AA Change: F1533L

PolyPhen 2 Score 0.334 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000072945
Gene: ENSMUSG00000024049
AA Change: F1533L

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
low complexity region 857 870 N/A INTRINSIC
FN3 916 1002 4.99e-11 SMART
FN3 1021 1106 2.04e-16 SMART
IG 1123 1208 3.1e0 SMART
IG_like 1231 1317 1.34e1 SMART
IG_like 1351 1417 4.79e0 SMART
IG_like 1454 1531 1.54e2 SMART
IGc2 1567 1635 2.05e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179759
AA Change: F1435L

PolyPhen 2 Score 0.245 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000136266
Gene: ENSMUSG00000024049
AA Change: F1435L

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
FN3 818 904 4.99e-11 SMART
FN3 923 1008 2.04e-16 SMART
IG 1025 1110 3.1e0 SMART
IG_like 1133 1219 1.34e1 SMART
IG_like 1253 1319 4.79e0 SMART
IG_like 1356 1433 1.54e2 SMART
IGc2 1469 1537 2.05e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180743
Meta Mutation Damage Score 0.0588 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.5%
Validation Efficiency 99% (95/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The giant protein titin, together with its associated proteins, interconnects the major structure of sarcomeres, the M bands and Z discs. The C-terminal end of the titin string extends into the M line, where it binds tightly to M-band constituents of apparent molecular masses of 190 kD (myomesin 1) and 165 kD (myomesin 2). This protein, myomesin 1, like myomesin 2, titin, and other myofibrillar proteins contains structural modules with strong homology to either fibronectin type III (motif I) or immunoglobulin C2 (motif II) domains. Myomesin 1 and myomesin 2 each have a unique N-terminal region followed by 12 modules of motif I or motif II, in the arrangement II-II-I-I-I-I-I-II-II-II-II-II. The two proteins share 50% sequence identity in this repeat-containing region. The head structure formed by these 2 proteins on one end of the titin string extends into the center of the M band. The integrating structure of the sarcomere arises from muscle-specific members of the superfamily of immunoglobulin-like proteins. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik A G 7: 131,357,660 S150P probably damaging Het
4932431P20Rik T A 7: 29,533,265 noncoding transcript Het
5530400C23Rik T G 6: 133,293,211 probably benign Het
Ahctf1 A C 1: 179,763,468 probably null Het
Ang5 T C 14: 43,962,749 V90A probably benign Het
Ano9 C T 7: 141,104,710 G442R probably damaging Het
Apaf1 G A 10: 91,060,052 T386I probably damaging Het
Apob C A 12: 8,006,440 H1608N probably damaging Het
Arhgap12 C A 18: 6,064,433 probably benign Het
Asxl1 T A 2: 153,399,904 D791E probably benign Het
Avl9 T C 6: 56,736,906 V383A probably benign Het
Btbd1 A C 7: 81,816,006 D197E probably damaging Het
C87499 A T 4: 88,629,299 I45K probably damaging Het
Camta2 T C 11: 70,673,959 I938V possibly damaging Het
Cdca7 C A 2: 72,483,467 A200D possibly damaging Het
Cep104 A T 4: 154,006,792 Y923F possibly damaging Het
Cep135 G C 5: 76,621,305 V601L probably benign Het
Ces2b G A 8: 104,835,910 G291S probably benign Het
Col6a6 C T 9: 105,761,440 G1400D probably damaging Het
Cyth2 T C 7: 45,813,117 E1G probably damaging Het
Dand5 A T 8: 84,816,292 L185Q probably damaging Het
Dck T C 5: 88,781,221 V253A probably benign Het
Ddx20 A G 3: 105,679,080 S650P probably damaging Het
Dicer1 G A 12: 104,706,864 P799S probably damaging Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
Eya2 G A 2: 165,769,237 C477Y probably damaging Het
Fam208b A T 13: 3,576,054 F1299I probably benign Het
Fip1l1 T A 5: 74,595,842 N498K probably damaging Het
Flt4 C T 11: 49,636,339 probably benign Het
Galntl6 T C 8: 57,837,183 probably null Het
Gda A T 19: 21,434,303 F44I possibly damaging Het
Gli2 G A 1: 118,840,389 R703C probably damaging Het
Gm14085 A T 2: 122,514,398 I162F probably damaging Het
Golgb1 T A 16: 36,916,271 L1960Q probably damaging Het
Gramd1b T C 9: 40,308,355 D341G probably damaging Het
Grid2 G T 6: 63,503,435 A78S probably benign Het
Hao2 A T 3: 98,883,560 probably benign Het
Hook3 A G 8: 26,118,986 V10A probably benign Het
Kif20a A G 18: 34,629,209 E425G probably damaging Het
Lrp1 T C 10: 127,567,383 D2107G probably benign Het
Lrriq3 T C 3: 155,187,736 I358T possibly damaging Het
Mad2l2 A G 4: 148,140,924 D17G possibly damaging Het
Mastl G T 2: 23,133,346 T455K probably benign Het
Mkln1 G T 6: 31,432,927 probably benign Het
Mmp1b A T 9: 7,387,947 Y16N possibly damaging Het
Mmp24 C T 2: 155,792,597 A79V probably benign Het
Mrps35 T A 6: 147,070,734 C292S possibly damaging Het
Nars2 C T 7: 97,039,923 H351Y probably damaging Het
Nat2 A T 8: 67,501,267 I10F probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Olfm5 A T 7: 104,153,869 Y462* probably null Het
Olfr1228 C A 2: 89,249,398 E87* probably null Het
Olfr1339 C T 4: 118,734,789 H87Y probably damaging Het
Olfr1508 T C 14: 52,463,509 I167V probably benign Het
Olfr322 C A 11: 58,666,160 F200L probably damaging Het
Olfr340 C A 2: 36,452,648 A21E probably benign Het
Olfr44 A T 9: 39,484,988 F85L probably benign Het
Olfr495 T A 7: 108,395,231 I37N probably damaging Het
Olfr855 T C 9: 19,585,304 S256P possibly damaging Het
Olfr926 T A 9: 38,877,815 I213N probably damaging Het
Otog A T 7: 46,251,395 probably benign Het
Pdcd2l A T 7: 34,192,807 D212E possibly damaging Het
Pex5 T C 6: 124,404,637 N213S probably benign Het
Pkn3 C T 2: 30,081,134 P238S probably benign Het
Prl2b1 A T 13: 27,390,740 probably null Het
Ptprb A T 10: 116,368,807 I1849L possibly damaging Het
Rasal3 G T 17: 32,393,526 S787Y probably damaging Het
Scn2a T A 2: 65,701,833 D596E possibly damaging Het
Sdhd A T 9: 50,603,764 V9D possibly damaging Het
Serinc5 T C 13: 92,708,057 S436P probably damaging Het
Slc27a1 C T 8: 71,584,164 P348L probably damaging Het
Smg1 G A 7: 118,160,383 probably benign Het
Sorl1 A T 9: 42,043,900 probably benign Het
Sprtn T A 8: 124,900,218 H112Q probably damaging Het
Tet2 A G 3: 133,467,602 M1633T probably benign Het
Tet2 T A 3: 133,467,725 D1592V probably benign Het
Tmem68 A T 4: 3,569,667 C8S probably damaging Het
Tnrc6a T A 7: 123,171,816 I943N probably benign Het
Trib2 A T 12: 15,794,068 V191D probably damaging Het
Tsc22d4 T C 5: 137,762,655 S113P probably damaging Het
Ttc21b T C 2: 66,239,570 R250G probably damaging Het
Ubr2 T C 17: 46,967,248 Y721C probably damaging Het
Ubtfl1 A T 9: 18,409,364 I63F probably damaging Het
Ush1c G A 7: 46,224,908 P171S probably benign Het
Utp20 A T 10: 88,767,461 N1843K probably damaging Het
Vangl1 A G 3: 102,166,937 Y285H probably damaging Het
Virma A G 4: 11,498,769 D70G probably damaging Het
Vmn2r102 T C 17: 19,678,015 F431L probably benign Het
Wdr17 A G 8: 54,661,495 I662T probably damaging Het
Wisp2 G A 2: 163,825,313 C78Y probably damaging Het
Zfp160 G A 17: 21,027,006 R606H probably benign Het
Zfp369 C T 13: 65,296,434 R464C probably damaging Het
Other mutations in Myom1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Myom1 APN 17 71126098 missense probably damaging 1.00
IGL00845:Myom1 APN 17 71084429 missense probably damaging 1.00
IGL00904:Myom1 APN 17 71099949 splice site probably benign
IGL00928:Myom1 APN 17 71089913 missense probably damaging 1.00
IGL01025:Myom1 APN 17 71077917 missense probably damaging 1.00
IGL01548:Myom1 APN 17 71101220 splice site probably benign
IGL01588:Myom1 APN 17 71117437 missense possibly damaging 0.94
IGL01614:Myom1 APN 17 71126178 missense possibly damaging 0.46
IGL01618:Myom1 APN 17 71099993 missense possibly damaging 0.87
IGL01619:Myom1 APN 17 71044476 splice site probably benign
IGL01766:Myom1 APN 17 71077288 missense probably damaging 1.00
IGL02105:Myom1 APN 17 71047716 splice site probably benign
IGL02122:Myom1 APN 17 71092137 missense probably damaging 1.00
IGL02184:Myom1 APN 17 71072137 missense possibly damaging 0.93
IGL02260:Myom1 APN 17 71108315 nonsense probably null
IGL02486:Myom1 APN 17 71099944 splice site probably benign
IGL02501:Myom1 APN 17 71072081 critical splice acceptor site probably null
IGL02642:Myom1 APN 17 71101098 missense possibly damaging 0.90
IGL02677:Myom1 APN 17 71084349 missense probably damaging 1.00
IGL02719:Myom1 APN 17 71106354 splice site probably benign
IGL02945:Myom1 APN 17 71092093 splice site probably benign
IGL03086:Myom1 APN 17 71108671 missense probably damaging 1.00
IGL03218:Myom1 APN 17 71084316 missense possibly damaging 0.46
R0107:Myom1 UTSW 17 71077365 missense probably damaging 1.00
R0130:Myom1 UTSW 17 71045755 missense probably damaging 0.98
R0133:Myom1 UTSW 17 71047787 missense probably damaging 1.00
R0206:Myom1 UTSW 17 71037297 missense probably damaging 1.00
R0206:Myom1 UTSW 17 71037297 missense probably damaging 1.00
R0352:Myom1 UTSW 17 71045749 missense possibly damaging 0.72
R0396:Myom1 UTSW 17 71034693 missense probably damaging 1.00
R0496:Myom1 UTSW 17 71084306 missense probably damaging 1.00
R0506:Myom1 UTSW 17 71092220 splice site probably benign
R0511:Myom1 UTSW 17 71084317 missense probably benign 0.22
R0699:Myom1 UTSW 17 71067313 missense probably damaging 0.98
R0791:Myom1 UTSW 17 71121136 missense probably damaging 1.00
R0792:Myom1 UTSW 17 71121136 missense probably damaging 1.00
R0963:Myom1 UTSW 17 71077767 missense possibly damaging 0.74
R1324:Myom1 UTSW 17 71052719 missense probably damaging 0.98
R2102:Myom1 UTSW 17 71101029 missense probably damaging 1.00
R2158:Myom1 UTSW 17 71064597 missense possibly damaging 0.83
R2336:Myom1 UTSW 17 71023194 missense possibly damaging 0.53
R2351:Myom1 UTSW 17 71034579 missense probably damaging 0.98
R2442:Myom1 UTSW 17 71110735 missense probably damaging 1.00
R2483:Myom1 UTSW 17 71077812 missense probably damaging 1.00
R2892:Myom1 UTSW 17 71034653 missense probably damaging 1.00
R2897:Myom1 UTSW 17 71101220 splice site probably benign
R3440:Myom1 UTSW 17 71045663 intron probably null
R3842:Myom1 UTSW 17 71045624 missense probably damaging 1.00
R4249:Myom1 UTSW 17 71092140 missense probably damaging 1.00
R4329:Myom1 UTSW 17 71036353 missense probably damaging 1.00
R4594:Myom1 UTSW 17 71100074 missense possibly damaging 0.73
R4873:Myom1 UTSW 17 71072119 missense probably damaging 1.00
R4875:Myom1 UTSW 17 71072119 missense probably damaging 1.00
R4876:Myom1 UTSW 17 71077410 missense probably damaging 1.00
R5171:Myom1 UTSW 17 71099972 missense possibly damaging 0.94
R5540:Myom1 UTSW 17 71109787 missense probably damaging 1.00
R5882:Myom1 UTSW 17 71110722 missense probably damaging 1.00
R5978:Myom1 UTSW 17 71117443 missense probably damaging 1.00
R6039:Myom1 UTSW 17 71110751 missense probably damaging 1.00
R6039:Myom1 UTSW 17 71110751 missense probably damaging 1.00
R6155:Myom1 UTSW 17 71108695 critical splice donor site probably null
R6261:Myom1 UTSW 17 71126137 missense probably damaging 1.00
R6284:Myom1 UTSW 17 71022892 nonsense probably null
R6313:Myom1 UTSW 17 71082488 missense probably benign
R6369:Myom1 UTSW 17 71101076 missense probably damaging 1.00
R6545:Myom1 UTSW 17 71082305 missense probably benign 0.00
R6738:Myom1 UTSW 17 71100398 intron probably null
R6933:Myom1 UTSW 17 71052671 missense probably damaging 1.00
X0019:Myom1 UTSW 17 71100071 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- AGGTTGAAGGCTCCTTGCTGAAATG -3'
(R):5'- GCAGCTCGACTAACAGTGTCAAGTG -3'

Sequencing Primer
(F):5'- TATGTGAAGCCATAGGCAGTCTC -3'
(R):5'- AACAGTGTCAAGTGGGCTCTTC -3'
Posted On2013-07-11