Incidental Mutation 'R7143:Pigc'
ID553509
Institutional Source Beutler Lab
Gene Symbol Pigc
Ensembl Gene ENSMUSG00000026698
Gene Namephosphatidylinositol glycan anchor biosynthesis, class C
Synonyms3110030E07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7143 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location161969186-161973435 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 161970592 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 48 (Y48H)
Ref Sequence ENSEMBL: ENSMUSP00000028021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028021] [ENSMUST00000111594] [ENSMUST00000159648] [ENSMUST00000160881] [ENSMUST00000162676] [ENSMUST00000193784]
Predicted Effect probably damaging
Transcript: ENSMUST00000028021
AA Change: Y48H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028021
Gene: ENSMUSG00000026698
AA Change: Y48H

DomainStartEndE-ValueType
Pfam:GPI2 14 284 6.2e-90 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111594
AA Change: Y48H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107221
Gene: ENSMUSG00000026698
AA Change: Y48H

DomainStartEndE-ValueType
Pfam:GPI2 14 284 1.7e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159648
Predicted Effect probably damaging
Transcript: ENSMUST00000160881
AA Change: Y48H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125321
Gene: ENSMUSG00000026698
AA Change: Y48H

DomainStartEndE-ValueType
Pfam:GPI2 14 140 2.8e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162676
SMART Domains Protein: ENSMUSP00000124751
Gene: ENSMUSG00000086277

DomainStartEndE-ValueType
Pfam:DUF4548 17 181 1.9e-89 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000193784
AA Change: Y48H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141646
Gene: ENSMUSG00000026698
AA Change: Y48H

DomainStartEndE-ValueType
Pfam:GPI2 14 284 1.7e-94 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an endoplasmic reticulum associated protein that is involved in glycosylphosphatidylinositol (GPI) lipid anchor biosynthesis. The GPI lipid anchor is a glycolipid found on many blood cells and serves to anchor proteins to the cell surface. The encoded protein is one subunit of the GPI N-acetylglucosaminyl (GlcNAc) transferase that transfers GlcNAc to phosphatidylinositol (PI) on the cytoplasmic side of the endoplasmic reticulum. Two alternatively spliced transcripts that encode the same protein have been found for this gene. A pseudogene on chromosome 11 has also been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930516K23Rik C T 7: 104,059,215 C129Y probably damaging Het
Agbl4 A G 4: 111,617,136 N374S probably damaging Het
Agl A G 3: 116,792,021 S153P probably damaging Het
Akap6 T G 12: 52,887,364 D546E probably benign Het
Ankrd17 C A 5: 90,285,961 A650S possibly damaging Het
Ankrd53 A G 6: 83,762,911 R16G possibly damaging Het
Apba2 T C 7: 64,744,417 L570P probably damaging Het
Asap1 A G 15: 64,191,528 F101L probably damaging Het
Cadm4 T A 7: 24,499,567 I89N possibly damaging Het
Cadps C T 14: 12,491,838 V771I probably benign Het
Cenph A G 13: 100,761,777 V206A possibly damaging Het
Cenpn A G 8: 116,937,227 T253A probably benign Het
Cep120 C T 18: 53,683,385 G939R probably benign Het
Cfap57 G A 4: 118,620,709 probably benign Het
Clip1 T C 5: 123,653,610 I166V probably benign Het
Cstf3 T A 2: 104,646,616 V144E probably benign Het
Cyp21a1 T A 17: 34,802,326 H357L probably damaging Het
Cyth3 T A 5: 143,684,396 V12E unknown Het
Dgat2 T C 7: 99,157,124 I289V probably benign Het
Dip2a A G 10: 76,297,791 C527R probably damaging Het
Dnah17 A C 11: 118,086,130 W1879G probably damaging Het
Dnaic2 A G 11: 114,754,250 T504A possibly damaging Het
Efl1 C T 7: 82,762,680 P759L probably damaging Het
Egfr A C 11: 16,871,627 I351L probably benign Het
Ercc6 G A 14: 32,570,305 E1209K probably damaging Het
Fam135b A T 15: 71,479,151 M292K probably benign Het
Fbxl7 C A 15: 26,543,158 V468L probably benign Het
Fhl2 G T 1: 43,141,851 H60N probably damaging Het
G6pc G T 11: 101,370,723 R83L probably damaging Het
Gata4 C A 14: 63,204,617 R252L probably damaging Het
Glt8d1 T A 14: 31,006,645 I10N probably damaging Het
Gm10471 T A 5: 26,085,676 I166F probably benign Het
Gm10803 T A 2: 93,563,959 Y25* probably null Het
Gm19345 T C 7: 19,857,834 F108S unknown Het
Gm4952 A G 19: 12,618,407 T54A possibly damaging Het
Gprc6a C T 10: 51,614,890 R921H probably benign Het
Hc A T 2: 35,050,438 H129Q probably benign Het
Heatr5a T C 12: 51,961,468 R31G probably benign Het
Hephl1 T C 9: 15,060,810 K945E possibly damaging Het
Ik G T 18: 36,751,177 M237I probably damaging Het
Izumo1 T A 7: 45,627,095 S361T probably benign Het
Kcnq4 A G 4: 120,711,239 F427L probably benign Het
Kifap3 A T 1: 163,825,859 N338I possibly damaging Het
Kifap3 T A 1: 163,856,040 M430K possibly damaging Het
Lamb3 A G 1: 193,304,565 E53G probably damaging Het
Lrp1b A T 2: 41,312,643 I1266K Het
Nat8 A T 6: 85,830,503 I216K probably benign Het
Ncapd2 T C 6: 125,179,561 I454V probably benign Het
Nlrp4f A T 13: 65,195,306 V153E probably damaging Het
Nlrp4f G C 13: 65,199,352 Q9E possibly damaging Het
Npy2r A T 3: 82,540,943 I175N probably benign Het
Nutm1 G A 2: 112,250,056 R505C probably damaging Het
Olfr1247 T C 2: 89,610,019 M28V probably benign Het
Olfr364-ps1 A G 2: 37,146,874 T221A probably benign Het
Olfr665 C T 7: 104,881,186 P160S probably damaging Het
Pcdh9 T C 14: 93,888,272 N154S probably damaging Het
Pcdhb2 A T 18: 37,295,881 E302D probably benign Het
Pclo T A 5: 14,858,822 V5048E unknown Het
Pcnt A G 10: 76,389,060 L1870S possibly damaging Het
Pisd C T 5: 32,738,502 V241I possibly damaging Het
Pkhd1l1 A T 15: 44,573,637 M3464L possibly damaging Het
Pofut2 T A 10: 77,259,426 I35N probably benign Het
Prss27 A G 17: 24,045,658 Y265C probably damaging Het
Prss56 T A 1: 87,188,153 I583K probably benign Het
Rnpep T C 1: 135,283,749 E87G probably benign Het
Shtn1 T C 19: 59,018,906 H304R probably damaging Het
Slc23a4 A T 6: 34,978,913 I62N probably damaging Het
Slc35e2 A T 4: 155,618,594 I355F probably benign Het
Snx25 T C 8: 46,035,715 I868V possibly damaging Het
Spatc1l T A 10: 76,569,931 L323Q probably damaging Het
Taok1 A G 11: 77,537,988 V962A probably benign Het
Tas2r140 A G 6: 133,055,519 I92T probably benign Het
Trim17 C A 11: 58,965,184 Y22* probably null Het
Tti1 T A 2: 158,007,676 M548L probably benign Het
Unc93b1 T C 19: 3,935,204 V4A unknown Het
Utp3 G C 5: 88,554,517 probably benign Het
Vmn1r225 A T 17: 20,502,384 Y29F probably benign Het
Vmn1r34 A T 6: 66,637,664 I30N probably benign Het
Vmn2r67 T A 7: 85,152,638 M152L probably benign Het
Wdr20rt T G 12: 65,225,918 F52V probably benign Het
Zfp869 G T 8: 69,706,656 H422Q probably damaging Het
Other mutations in Pigc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01725:Pigc APN 1 161971345 utr 3 prime probably benign
IGL02009:Pigc APN 1 161970565 missense probably damaging 1.00
IGL02586:Pigc APN 1 161970934 missense probably benign 0.02
IGL03095:Pigc APN 1 161970776 missense possibly damaging 0.79
IGL03109:Pigc APN 1 161970776 missense possibly damaging 0.79
apocryphon UTSW 1 161971094 missense probably benign 0.21
pistis UTSW 1 161970947 missense probably damaging 0.99
R6228_Pigc_444 UTSW 1 161970467 missense probably benign 0.03
R0321:Pigc UTSW 1 161971099 nonsense probably null
R1450:Pigc UTSW 1 161971253 missense probably benign 0.01
R1708:Pigc UTSW 1 161970724 missense probably benign 0.00
R1857:Pigc UTSW 1 161970877 missense possibly damaging 0.90
R1875:Pigc UTSW 1 161970947 missense probably damaging 0.99
R2371:Pigc UTSW 1 161971010 missense possibly damaging 0.72
R2940:Pigc UTSW 1 161970670 missense possibly damaging 0.96
R3706:Pigc UTSW 1 161971094 missense probably benign 0.21
R3707:Pigc UTSW 1 161971094 missense probably benign 0.21
R3708:Pigc UTSW 1 161971094 missense probably benign 0.21
R3725:Pigc UTSW 1 161971291 missense possibly damaging 0.95
R5193:Pigc UTSW 1 161970896 missense possibly damaging 0.91
R5682:Pigc UTSW 1 161970947 missense probably damaging 0.99
R6228:Pigc UTSW 1 161970467 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GAGCCAACCTGGATTTGAGG -3'
(R):5'- AGAGTACTCTTCAGGTCGGC -3'

Sequencing Primer
(F):5'- CCAACCTGGATTTGAGGAAAGAATG -3'
(R):5'- GTCCATCACCTCCATCGATAAG -3'
Posted On2019-05-15