Incidental Mutation 'R7143:Slc35e2'
ID553526
Institutional Source Beutler Lab
Gene Symbol Slc35e2
Ensembl Gene ENSMUSG00000042202
Gene Namesolute carrier family 35, member E2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7143 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location155601416-155623340 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 155618594 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 355 (I355F)
Ref Sequence ENSEMBL: ENSMUSP00000041449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043829] [ENSMUST00000105608] [ENSMUST00000115821] [ENSMUST00000118607]
Predicted Effect probably benign
Transcript: ENSMUST00000043829
AA Change: I355F

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000041449
Gene: ENSMUSG00000042202
AA Change: I355F

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
low complexity region 50 66 N/A INTRINSIC
Pfam:TPT 73 368 7.9e-93 PFAM
Pfam:UAA 74 371 1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105608
AA Change: I355F

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000101233
Gene: ENSMUSG00000042202
AA Change: I355F

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
low complexity region 50 66 N/A INTRINSIC
Pfam:UAA 75 375 6.9e-10 PFAM
Pfam:EamA 84 215 5.8e-8 PFAM
Pfam:TPT 224 369 3.8e-34 PFAM
Pfam:EamA 237 369 3.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115821
SMART Domains Protein: ENSMUSP00000111488
Gene: ENSMUSG00000073682

DomainStartEndE-ValueType
SCOP:d1l9ha_ 17 52 2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118607
AA Change: I355F

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000113189
Gene: ENSMUSG00000042202
AA Change: I355F

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
low complexity region 50 66 N/A INTRINSIC
Pfam:UAA 75 375 6.9e-10 PFAM
Pfam:EamA 84 215 5.8e-8 PFAM
Pfam:TPT 224 369 3.8e-34 PFAM
Pfam:EamA 237 369 3.4e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930516K23Rik C T 7: 104,059,215 C129Y probably damaging Het
Agbl4 A G 4: 111,617,136 N374S probably damaging Het
Agl A G 3: 116,792,021 S153P probably damaging Het
Akap6 T G 12: 52,887,364 D546E probably benign Het
Ankrd17 C A 5: 90,285,961 A650S possibly damaging Het
Ankrd53 A G 6: 83,762,911 R16G possibly damaging Het
Apba2 T C 7: 64,744,417 L570P probably damaging Het
Asap1 A G 15: 64,191,528 F101L probably damaging Het
Cadm4 T A 7: 24,499,567 I89N possibly damaging Het
Cadps C T 14: 12,491,838 V771I probably benign Het
Cenph A G 13: 100,761,777 V206A possibly damaging Het
Cenpn A G 8: 116,937,227 T253A probably benign Het
Cep120 C T 18: 53,683,385 G939R probably benign Het
Cfap57 G A 4: 118,620,709 probably benign Het
Clip1 T C 5: 123,653,610 I166V probably benign Het
Cstf3 T A 2: 104,646,616 V144E probably benign Het
Cyp21a1 T A 17: 34,802,326 H357L probably damaging Het
Cyth3 T A 5: 143,684,396 V12E unknown Het
Dgat2 T C 7: 99,157,124 I289V probably benign Het
Dip2a A G 10: 76,297,791 C527R probably damaging Het
Dnah17 A C 11: 118,086,130 W1879G probably damaging Het
Dnaic2 A G 11: 114,754,250 T504A possibly damaging Het
Efl1 C T 7: 82,762,680 P759L probably damaging Het
Egfr A C 11: 16,871,627 I351L probably benign Het
Ercc6 G A 14: 32,570,305 E1209K probably damaging Het
Fam135b A T 15: 71,479,151 M292K probably benign Het
Fbxl7 C A 15: 26,543,158 V468L probably benign Het
Fhl2 G T 1: 43,141,851 H60N probably damaging Het
G6pc G T 11: 101,370,723 R83L probably damaging Het
Gata4 C A 14: 63,204,617 R252L probably damaging Het
Glt8d1 T A 14: 31,006,645 I10N probably damaging Het
Gm10471 T A 5: 26,085,676 I166F probably benign Het
Gm10803 T A 2: 93,563,959 Y25* probably null Het
Gm19345 T C 7: 19,857,834 F108S unknown Het
Gm4952 A G 19: 12,618,407 T54A possibly damaging Het
Gprc6a C T 10: 51,614,890 R921H probably benign Het
Hc A T 2: 35,050,438 H129Q probably benign Het
Heatr5a T C 12: 51,961,468 R31G probably benign Het
Hephl1 T C 9: 15,060,810 K945E possibly damaging Het
Ik G T 18: 36,751,177 M237I probably damaging Het
Izumo1 T A 7: 45,627,095 S361T probably benign Het
Kcnq4 A G 4: 120,711,239 F427L probably benign Het
Kifap3 A T 1: 163,825,859 N338I possibly damaging Het
Kifap3 T A 1: 163,856,040 M430K possibly damaging Het
Lamb3 A G 1: 193,304,565 E53G probably damaging Het
Lrp1b A T 2: 41,312,643 I1266K Het
Nat8 A T 6: 85,830,503 I216K probably benign Het
Ncapd2 T C 6: 125,179,561 I454V probably benign Het
Nlrp4f G C 13: 65,199,352 Q9E possibly damaging Het
Nlrp4f A T 13: 65,195,306 V153E probably damaging Het
Npy2r A T 3: 82,540,943 I175N probably benign Het
Nutm1 G A 2: 112,250,056 R505C probably damaging Het
Olfr1247 T C 2: 89,610,019 M28V probably benign Het
Olfr364-ps1 A G 2: 37,146,874 T221A probably benign Het
Olfr665 C T 7: 104,881,186 P160S probably damaging Het
Pcdh9 T C 14: 93,888,272 N154S probably damaging Het
Pcdhb2 A T 18: 37,295,881 E302D probably benign Het
Pclo T A 5: 14,858,822 V5048E unknown Het
Pcnt A G 10: 76,389,060 L1870S possibly damaging Het
Pigc T C 1: 161,970,592 Y48H probably damaging Het
Pisd C T 5: 32,738,502 V241I possibly damaging Het
Pkhd1l1 A T 15: 44,573,637 M3464L possibly damaging Het
Pofut2 T A 10: 77,259,426 I35N probably benign Het
Prss27 A G 17: 24,045,658 Y265C probably damaging Het
Prss56 T A 1: 87,188,153 I583K probably benign Het
Rnpep T C 1: 135,283,749 E87G probably benign Het
Shtn1 T C 19: 59,018,906 H304R probably damaging Het
Slc23a4 A T 6: 34,978,913 I62N probably damaging Het
Snx25 T C 8: 46,035,715 I868V possibly damaging Het
Spatc1l T A 10: 76,569,931 L323Q probably damaging Het
Taok1 A G 11: 77,537,988 V962A probably benign Het
Tas2r140 A G 6: 133,055,519 I92T probably benign Het
Trim17 C A 11: 58,965,184 Y22* probably null Het
Tti1 T A 2: 158,007,676 M548L probably benign Het
Unc93b1 T C 19: 3,935,204 V4A unknown Het
Utp3 G C 5: 88,554,517 probably benign Het
Vmn1r225 A T 17: 20,502,384 Y29F probably benign Het
Vmn1r34 A T 6: 66,637,664 I30N probably benign Het
Vmn2r67 T A 7: 85,152,638 M152L probably benign Het
Wdr20rt T G 12: 65,225,918 F52V probably benign Het
Zfp869 G T 8: 69,706,656 H422Q probably damaging Het
Other mutations in Slc35e2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01919:Slc35e2 APN 4 155612730 missense probably benign
IGL02244:Slc35e2 APN 4 155618562 missense probably damaging 0.97
R1774:Slc35e2 UTSW 4 155610164 missense possibly damaging 0.51
R1856:Slc35e2 UTSW 4 155611729 missense probably damaging 1.00
R4600:Slc35e2 UTSW 4 155617649 missense probably benign 0.04
R4601:Slc35e2 UTSW 4 155617649 missense probably benign 0.04
R4603:Slc35e2 UTSW 4 155617649 missense probably benign 0.04
R4610:Slc35e2 UTSW 4 155617649 missense probably benign 0.04
R4917:Slc35e2 UTSW 4 155616236 missense probably damaging 1.00
R4918:Slc35e2 UTSW 4 155616236 missense probably damaging 1.00
R5440:Slc35e2 UTSW 4 155610026 missense probably benign
R5468:Slc35e2 UTSW 4 155610026 missense probably benign
R5469:Slc35e2 UTSW 4 155610026 missense probably benign
R5470:Slc35e2 UTSW 4 155610026 missense probably benign
R5512:Slc35e2 UTSW 4 155610026 missense probably benign
R5513:Slc35e2 UTSW 4 155610026 missense probably benign
R5514:Slc35e2 UTSW 4 155610026 missense probably benign
R5689:Slc35e2 UTSW 4 155610026 missense probably benign
R5692:Slc35e2 UTSW 4 155610026 missense probably benign
R5711:Slc35e2 UTSW 4 155610026 missense probably benign
R5714:Slc35e2 UTSW 4 155610026 missense probably benign
R5799:Slc35e2 UTSW 4 155610026 missense probably benign
R5872:Slc35e2 UTSW 4 155612680 missense probably damaging 1.00
R5925:Slc35e2 UTSW 4 155611627 missense probably damaging 1.00
R5947:Slc35e2 UTSW 4 155611714 missense possibly damaging 0.70
R6044:Slc35e2 UTSW 4 155610026 missense probably benign
R6063:Slc35e2 UTSW 4 155610026 missense probably benign
R6065:Slc35e2 UTSW 4 155610026 missense probably benign
R6066:Slc35e2 UTSW 4 155610026 missense probably benign
R6188:Slc35e2 UTSW 4 155610026 missense probably benign
R6243:Slc35e2 UTSW 4 155610026 missense probably benign
R6273:Slc35e2 UTSW 4 155610026 missense probably benign
R6484:Slc35e2 UTSW 4 155612647 missense probably damaging 0.99
R6867:Slc35e2 UTSW 4 155618700 missense probably benign 0.00
R7384:Slc35e2 UTSW 4 155610632 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGATGGACAACACAGCACTG -3'
(R):5'- TAGTACAGAAGGAACATCTAGGCC -3'

Sequencing Primer
(F):5'- CACTGTTGCATTGTGTGACATTC -3'
(R):5'- GGAACATCTAGGCCTGGATCTAC -3'
Posted On2019-05-15