Incidental Mutation 'R7143:Pisd'
ID553529
Institutional Source Beutler Lab
Gene Symbol Pisd
Ensembl Gene ENSMUSG00000023452
Gene Namephosphatidylserine decarboxylase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7143 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location32736301-32785646 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 32738502 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 241 (V241I)
Ref Sequence ENSEMBL: ENSMUSP00000051438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061895] [ENSMUST00000071829] [ENSMUST00000120591] [ENSMUST00000135248] [ENSMUST00000142957] [ENSMUST00000144673] [ENSMUST00000197787] [ENSMUST00000200390] [ENSMUST00000202283]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061895
AA Change: V241I

PolyPhen 2 Score 0.726 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000051438
Gene: ENSMUSG00000023452
AA Change: V241I

DomainStartEndE-ValueType
Pfam:PS_Dcarbxylase 162 405 1.1e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071829
AA Change: V210I

PolyPhen 2 Score 0.198 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000071732
Gene: ENSMUSG00000023452
AA Change: V210I

DomainStartEndE-ValueType
Pfam:PS_Dcarbxylase 131 260 3.9e-35 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120591
AA Change: V210I

PolyPhen 2 Score 0.568 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112573
Gene: ENSMUSG00000023452
AA Change: V210I

DomainStartEndE-ValueType
Pfam:PS_Dcarbxylase 131 374 1.1e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135248
Predicted Effect
SMART Domains Protein: ENSMUSP00000122705
Gene: ENSMUSG00000023452
AA Change: V231I

DomainStartEndE-ValueType
Pfam:PS_Dcarbxylase 153 270 1.7e-33 PFAM
Pfam:PS_Dcarbxylase 268 358 2.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142957
Predicted Effect possibly damaging
Transcript: ENSMUST00000144673
AA Change: V411I

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124923
Gene: ENSMUSG00000093574
AA Change: V411I

DomainStartEndE-ValueType
Pfam:Tantalus 158 193 1.2e-15 PFAM
Pfam:PS_Dcarbxylase 332 575 2.1e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197787
Predicted Effect probably benign
Transcript: ENSMUST00000200390
Predicted Effect probably benign
Transcript: ENSMUST00000202283
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the conversion of phosphatidylserine to phosphatidylethanolamine in the inner mitochondrial membrane. The encoded protein is active in phospholipid metabolism and interorganelle trafficking of phosphatidylserine. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for a null mutation in this gene display embryogenesis defects such as abnormal trophoblast development, abnormal extraembronic tissue morphology and abnormal mitochondrial morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930516K23Rik C T 7: 104,059,215 C129Y probably damaging Het
Agbl4 A G 4: 111,617,136 N374S probably damaging Het
Agl A G 3: 116,792,021 S153P probably damaging Het
Akap6 T G 12: 52,887,364 D546E probably benign Het
Ankrd17 C A 5: 90,285,961 A650S possibly damaging Het
Ankrd53 A G 6: 83,762,911 R16G possibly damaging Het
Apba2 T C 7: 64,744,417 L570P probably damaging Het
Asap1 A G 15: 64,191,528 F101L probably damaging Het
Cadm4 T A 7: 24,499,567 I89N possibly damaging Het
Cadps C T 14: 12,491,838 V771I probably benign Het
Cenph A G 13: 100,761,777 V206A possibly damaging Het
Cenpn A G 8: 116,937,227 T253A probably benign Het
Cep120 C T 18: 53,683,385 G939R probably benign Het
Cfap57 G A 4: 118,620,709 probably benign Het
Clip1 T C 5: 123,653,610 I166V probably benign Het
Cstf3 T A 2: 104,646,616 V144E probably benign Het
Cyp21a1 T A 17: 34,802,326 H357L probably damaging Het
Cyth3 T A 5: 143,684,396 V12E unknown Het
Dgat2 T C 7: 99,157,124 I289V probably benign Het
Dip2a A G 10: 76,297,791 C527R probably damaging Het
Dnah17 A C 11: 118,086,130 W1879G probably damaging Het
Dnaic2 A G 11: 114,754,250 T504A possibly damaging Het
Efl1 C T 7: 82,762,680 P759L probably damaging Het
Egfr A C 11: 16,871,627 I351L probably benign Het
Ercc6 G A 14: 32,570,305 E1209K probably damaging Het
Fam135b A T 15: 71,479,151 M292K probably benign Het
Fbxl7 C A 15: 26,543,158 V468L probably benign Het
Fhl2 G T 1: 43,141,851 H60N probably damaging Het
G6pc G T 11: 101,370,723 R83L probably damaging Het
Gata4 C A 14: 63,204,617 R252L probably damaging Het
Glt8d1 T A 14: 31,006,645 I10N probably damaging Het
Gm10471 T A 5: 26,085,676 I166F probably benign Het
Gm10803 T A 2: 93,563,959 Y25* probably null Het
Gm19345 T C 7: 19,857,834 F108S unknown Het
Gm4952 A G 19: 12,618,407 T54A possibly damaging Het
Gprc6a C T 10: 51,614,890 R921H probably benign Het
Hc A T 2: 35,050,438 H129Q probably benign Het
Heatr5a T C 12: 51,961,468 R31G probably benign Het
Hephl1 T C 9: 15,060,810 K945E possibly damaging Het
Ik G T 18: 36,751,177 M237I probably damaging Het
Izumo1 T A 7: 45,627,095 S361T probably benign Het
Kcnq4 A G 4: 120,711,239 F427L probably benign Het
Kifap3 A T 1: 163,825,859 N338I possibly damaging Het
Kifap3 T A 1: 163,856,040 M430K possibly damaging Het
Lamb3 A G 1: 193,304,565 E53G probably damaging Het
Lrp1b A T 2: 41,312,643 I1266K Het
Nat8 A T 6: 85,830,503 I216K probably benign Het
Ncapd2 T C 6: 125,179,561 I454V probably benign Het
Nlrp4f A T 13: 65,195,306 V153E probably damaging Het
Nlrp4f G C 13: 65,199,352 Q9E possibly damaging Het
Npy2r A T 3: 82,540,943 I175N probably benign Het
Nutm1 G A 2: 112,250,056 R505C probably damaging Het
Olfr1247 T C 2: 89,610,019 M28V probably benign Het
Olfr364-ps1 A G 2: 37,146,874 T221A probably benign Het
Olfr665 C T 7: 104,881,186 P160S probably damaging Het
Pcdh9 T C 14: 93,888,272 N154S probably damaging Het
Pcdhb2 A T 18: 37,295,881 E302D probably benign Het
Pclo T A 5: 14,858,822 V5048E unknown Het
Pcnt A G 10: 76,389,060 L1870S possibly damaging Het
Pigc T C 1: 161,970,592 Y48H probably damaging Het
Pkhd1l1 A T 15: 44,573,637 M3464L possibly damaging Het
Pofut2 T A 10: 77,259,426 I35N probably benign Het
Prss27 A G 17: 24,045,658 Y265C probably damaging Het
Prss56 T A 1: 87,188,153 I583K probably benign Het
Rnpep T C 1: 135,283,749 E87G probably benign Het
Shtn1 T C 19: 59,018,906 H304R probably damaging Het
Slc23a4 A T 6: 34,978,913 I62N probably damaging Het
Slc35e2 A T 4: 155,618,594 I355F probably benign Het
Snx25 T C 8: 46,035,715 I868V possibly damaging Het
Spatc1l T A 10: 76,569,931 L323Q probably damaging Het
Taok1 A G 11: 77,537,988 V962A probably benign Het
Tas2r140 A G 6: 133,055,519 I92T probably benign Het
Trim17 C A 11: 58,965,184 Y22* probably null Het
Tti1 T A 2: 158,007,676 M548L probably benign Het
Unc93b1 T C 19: 3,935,204 V4A unknown Het
Utp3 G C 5: 88,554,517 probably benign Het
Vmn1r225 A T 17: 20,502,384 Y29F probably benign Het
Vmn1r34 A T 6: 66,637,664 I30N probably benign Het
Vmn2r67 T A 7: 85,152,638 M152L probably benign Het
Wdr20rt T G 12: 65,225,918 F52V probably benign Het
Zfp869 G T 8: 69,706,656 H422Q probably damaging Het
Other mutations in Pisd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Pisd APN 5 32738412 missense probably benign 0.02
IGL00540:Pisd APN 5 32738412 missense probably benign 0.02
IGL00577:Pisd APN 5 32738412 missense probably benign 0.02
IGL00580:Pisd APN 5 32738412 missense probably benign 0.02
IGL00590:Pisd APN 5 32738412 missense probably benign 0.02
IGL00990:Pisd APN 5 32739358 missense probably benign 0.24
IGL01899:Pisd APN 5 32739132 splice site probably null
IGL01908:Pisd APN 5 32739132 splice site probably null
IGL01928:Pisd APN 5 32739132 splice site probably null
IGL01931:Pisd APN 5 32739132 splice site probably null
IGL01935:Pisd APN 5 32739132 splice site probably null
IGL01948:Pisd APN 5 32739132 splice site probably null
IGL01952:Pisd APN 5 32739132 splice site probably null
IGL02195:Pisd APN 5 32737315 missense probably damaging 1.00
shandong UTSW 5 32764796 missense possibly damaging 0.94
R0674:Pisd UTSW 5 32774437 missense probably benign 0.00
R0840:Pisd UTSW 5 32737312 missense probably damaging 1.00
R1976:Pisd UTSW 5 32738865 missense probably damaging 1.00
R1986:Pisd UTSW 5 32737328 missense probably damaging 1.00
R2044:Pisd UTSW 5 32764796 missense possibly damaging 0.94
R5705:Pisd UTSW 5 32737363 missense probably benign 0.14
R5756:Pisd UTSW 5 32738498 missense probably damaging 1.00
R6249:Pisd UTSW 5 32738844 missense probably damaging 1.00
R6389:Pisd UTSW 5 32764847 missense probably damaging 1.00
R6913:Pisd UTSW 5 32737429 missense probably damaging 1.00
R7571:Pisd UTSW 5 32737337 missense not run
Predicted Primers PCR Primer
(F):5'- AGTCCTCCCAAGTCAAAAGG -3'
(R):5'- TTGGTAGCTGGAGCAAAGGC -3'

Sequencing Primer
(F):5'- CCAAGTCAAAAGGCCCAGGG -3'
(R):5'- GGCTGAGGGAATAAAGGCTG -3'
Posted On2019-05-15