Incidental Mutation 'R7143:Pcnt'
ID553555
Institutional Source Beutler Lab
Gene Symbol Pcnt
Ensembl Gene ENSMUSG00000001151
Gene Namepericentrin (kendrin)
Synonymsm239Asp, m275Asp, Pcnt2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7143 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location76351263-76442786 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76389060 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 1870 (L1870S)
Ref Sequence ENSEMBL: ENSMUSP00000151534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001179] [ENSMUST00000217838]
Predicted Effect probably damaging
Transcript: ENSMUST00000001179
AA Change: L1870S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000001179
Gene: ENSMUSG00000001151
AA Change: L1870S

DomainStartEndE-ValueType
internal_repeat_1 7 78 2.47e-5 PROSPERO
low complexity region 104 114 N/A INTRINSIC
coiled coil region 131 229 N/A INTRINSIC
internal_repeat_3 241 259 6.69e-5 PROSPERO
low complexity region 313 325 N/A INTRINSIC
internal_repeat_3 391 409 6.69e-5 PROSPERO
low complexity region 456 467 N/A INTRINSIC
coiled coil region 468 520 N/A INTRINSIC
coiled coil region 554 581 N/A INTRINSIC
low complexity region 652 666 N/A INTRINSIC
coiled coil region 727 787 N/A INTRINSIC
coiled coil region 871 916 N/A INTRINSIC
low complexity region 931 942 N/A INTRINSIC
low complexity region 969 985 N/A INTRINSIC
coiled coil region 1055 1383 N/A INTRINSIC
coiled coil region 1429 1481 N/A INTRINSIC
coiled coil region 1529 1567 N/A INTRINSIC
low complexity region 1614 1624 N/A INTRINSIC
internal_repeat_2 1916 1964 2.47e-5 PROSPERO
coiled coil region 2158 2178 N/A INTRINSIC
coiled coil region 2211 2279 N/A INTRINSIC
coiled coil region 2300 2421 N/A INTRINSIC
coiled coil region 2447 2526 N/A INTRINSIC
Pfam:PACT_coil_coil 2718 2797 5.8e-29 PFAM
internal_repeat_1 2820 2885 2.47e-5 PROSPERO
internal_repeat_2 2844 2891 2.47e-5 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000217838
AA Change: L1870S

PolyPhen 2 Score 0.472 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele display mitotic spindle misorientation, microcephaly, craniofacial developmental anomalies, such as cleft palate and eye defects, variable structural kidney and cardiovascular defects, and altered hemodynamics leading to heart failure and prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930516K23Rik C T 7: 104,059,215 C129Y probably damaging Het
Agbl4 A G 4: 111,617,136 N374S probably damaging Het
Agl A G 3: 116,792,021 S153P probably damaging Het
Akap6 T G 12: 52,887,364 D546E probably benign Het
Ankrd17 C A 5: 90,285,961 A650S possibly damaging Het
Ankrd53 A G 6: 83,762,911 R16G possibly damaging Het
Apba2 T C 7: 64,744,417 L570P probably damaging Het
Asap1 A G 15: 64,191,528 F101L probably damaging Het
Cadm4 T A 7: 24,499,567 I89N possibly damaging Het
Cadps C T 14: 12,491,838 V771I probably benign Het
Cenph A G 13: 100,761,777 V206A possibly damaging Het
Cenpn A G 8: 116,937,227 T253A probably benign Het
Cep120 C T 18: 53,683,385 G939R probably benign Het
Cfap57 G A 4: 118,620,709 probably benign Het
Clip1 T C 5: 123,653,610 I166V probably benign Het
Cstf3 T A 2: 104,646,616 V144E probably benign Het
Cyp21a1 T A 17: 34,802,326 H357L probably damaging Het
Cyth3 T A 5: 143,684,396 V12E unknown Het
Dgat2 T C 7: 99,157,124 I289V probably benign Het
Dip2a A G 10: 76,297,791 C527R probably damaging Het
Dnah17 A C 11: 118,086,130 W1879G probably damaging Het
Dnaic2 A G 11: 114,754,250 T504A possibly damaging Het
Efl1 C T 7: 82,762,680 P759L probably damaging Het
Egfr A C 11: 16,871,627 I351L probably benign Het
Ercc6 G A 14: 32,570,305 E1209K probably damaging Het
Fam135b A T 15: 71,479,151 M292K probably benign Het
Fbxl7 C A 15: 26,543,158 V468L probably benign Het
Fhl2 G T 1: 43,141,851 H60N probably damaging Het
G6pc G T 11: 101,370,723 R83L probably damaging Het
Gata4 C A 14: 63,204,617 R252L probably damaging Het
Glt8d1 T A 14: 31,006,645 I10N probably damaging Het
Gm10471 T A 5: 26,085,676 I166F probably benign Het
Gm10803 T A 2: 93,563,959 Y25* probably null Het
Gm19345 T C 7: 19,857,834 F108S unknown Het
Gm4952 A G 19: 12,618,407 T54A possibly damaging Het
Gprc6a C T 10: 51,614,890 R921H probably benign Het
Hc A T 2: 35,050,438 H129Q probably benign Het
Heatr5a T C 12: 51,961,468 R31G probably benign Het
Hephl1 T C 9: 15,060,810 K945E possibly damaging Het
Ik G T 18: 36,751,177 M237I probably damaging Het
Izumo1 T A 7: 45,627,095 S361T probably benign Het
Kcnq4 A G 4: 120,711,239 F427L probably benign Het
Kifap3 A T 1: 163,825,859 N338I possibly damaging Het
Kifap3 T A 1: 163,856,040 M430K possibly damaging Het
Lamb3 A G 1: 193,304,565 E53G probably damaging Het
Lrp1b A T 2: 41,312,643 I1266K Het
Nat8 A T 6: 85,830,503 I216K probably benign Het
Ncapd2 T C 6: 125,179,561 I454V probably benign Het
Nlrp4f A T 13: 65,195,306 V153E probably damaging Het
Nlrp4f G C 13: 65,199,352 Q9E possibly damaging Het
Npy2r A T 3: 82,540,943 I175N probably benign Het
Nutm1 G A 2: 112,250,056 R505C probably damaging Het
Olfr1247 T C 2: 89,610,019 M28V probably benign Het
Olfr364-ps1 A G 2: 37,146,874 T221A probably benign Het
Olfr665 C T 7: 104,881,186 P160S probably damaging Het
Pcdh9 T C 14: 93,888,272 N154S probably damaging Het
Pcdhb2 A T 18: 37,295,881 E302D probably benign Het
Pclo T A 5: 14,858,822 V5048E unknown Het
Pigc T C 1: 161,970,592 Y48H probably damaging Het
Pisd C T 5: 32,738,502 V241I possibly damaging Het
Pkhd1l1 A T 15: 44,573,637 M3464L possibly damaging Het
Pofut2 T A 10: 77,259,426 I35N probably benign Het
Prss27 A G 17: 24,045,658 Y265C probably damaging Het
Prss56 T A 1: 87,188,153 I583K probably benign Het
Rnpep T C 1: 135,283,749 E87G probably benign Het
Shtn1 T C 19: 59,018,906 H304R probably damaging Het
Slc23a4 A T 6: 34,978,913 I62N probably damaging Het
Slc35e2 A T 4: 155,618,594 I355F probably benign Het
Snx25 T C 8: 46,035,715 I868V possibly damaging Het
Spatc1l T A 10: 76,569,931 L323Q probably damaging Het
Taok1 A G 11: 77,537,988 V962A probably benign Het
Tas2r140 A G 6: 133,055,519 I92T probably benign Het
Trim17 C A 11: 58,965,184 Y22* probably null Het
Tti1 T A 2: 158,007,676 M548L probably benign Het
Unc93b1 T C 19: 3,935,204 V4A unknown Het
Utp3 G C 5: 88,554,517 probably benign Het
Vmn1r225 A T 17: 20,502,384 Y29F probably benign Het
Vmn1r34 A T 6: 66,637,664 I30N probably benign Het
Vmn2r67 T A 7: 85,152,638 M152L probably benign Het
Wdr20rt T G 12: 65,225,918 F52V probably benign Het
Zfp869 G T 8: 69,706,656 H422Q probably damaging Het
Other mutations in Pcnt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01075:Pcnt APN 10 76422904 nonsense probably null
IGL01307:Pcnt APN 10 76411588 missense probably damaging 1.00
IGL01549:Pcnt APN 10 76367486 splice site probably null
IGL01576:Pcnt APN 10 76368822 missense probably damaging 0.99
IGL01611:Pcnt APN 10 76436424 critical splice donor site probably null
IGL01630:Pcnt APN 10 76420246 missense probably damaging 0.99
IGL01647:Pcnt APN 10 76370001 nonsense probably null
IGL01689:Pcnt APN 10 76411653 missense probably damaging 1.00
IGL01690:Pcnt APN 10 76392775 missense probably damaging 1.00
IGL01723:Pcnt APN 10 76418499 missense possibly damaging 0.63
IGL01920:Pcnt APN 10 76404528 missense probably damaging 1.00
IGL01958:Pcnt APN 10 76433679 missense probably damaging 0.96
IGL02210:Pcnt APN 10 76389219 missense possibly damaging 0.95
IGL02225:Pcnt APN 10 76389474 missense probably benign 0.00
IGL02228:Pcnt APN 10 76389474 missense probably benign 0.00
IGL02237:Pcnt APN 10 76352984 missense probably damaging 1.00
IGL02279:Pcnt APN 10 76403765 missense probably damaging 1.00
IGL02303:Pcnt APN 10 76442559 splice site probably benign
IGL02355:Pcnt APN 10 76375162 nonsense probably null
IGL02362:Pcnt APN 10 76375162 nonsense probably null
IGL02428:Pcnt APN 10 76429256 missense probably damaging 0.99
IGL02536:Pcnt APN 10 76380229 missense possibly damaging 0.68
IGL02715:Pcnt APN 10 76368722 splice site probably benign
IGL02800:Pcnt APN 10 76412583 nonsense probably null
IGL03395:Pcnt APN 10 76436491 missense possibly damaging 0.95
IGL02799:Pcnt UTSW 10 76412583 nonsense probably null
PIT4520001:Pcnt UTSW 10 76420235 missense probably damaging 0.99
R0049:Pcnt UTSW 10 76369821 unclassified probably benign
R0049:Pcnt UTSW 10 76369821 unclassified probably benign
R0109:Pcnt UTSW 10 76389196 missense probably benign 0.00
R0117:Pcnt UTSW 10 76408727 nonsense probably null
R0254:Pcnt UTSW 10 76392580 missense probably benign 0.10
R0392:Pcnt UTSW 10 76384826 missense probably benign
R0511:Pcnt UTSW 10 76404595 missense possibly damaging 0.66
R0570:Pcnt UTSW 10 76412107 missense probably damaging 1.00
R0614:Pcnt UTSW 10 76420316 missense probably damaging 1.00
R0635:Pcnt UTSW 10 76404585 missense probably damaging 1.00
R0707:Pcnt UTSW 10 76420541 missense probably damaging 1.00
R0749:Pcnt UTSW 10 76381364 missense probably damaging 1.00
R0969:Pcnt UTSW 10 76427951 missense probably damaging 1.00
R1172:Pcnt UTSW 10 76393044 splice site probably null
R1174:Pcnt UTSW 10 76393044 splice site probably null
R1175:Pcnt UTSW 10 76393044 splice site probably null
R1512:Pcnt UTSW 10 76404662 splice site probably null
R1542:Pcnt UTSW 10 76389387 missense probably benign 0.08
R1542:Pcnt UTSW 10 76401386 missense probably benign 0.02
R1558:Pcnt UTSW 10 76422922 missense possibly damaging 0.53
R1562:Pcnt UTSW 10 76367330 missense probably benign 0.02
R1762:Pcnt UTSW 10 76355137 critical splice acceptor site probably null
R1779:Pcnt UTSW 10 76408796 missense probably damaging 0.99
R1869:Pcnt UTSW 10 76379906 missense probably null 0.94
R1911:Pcnt UTSW 10 76368816 missense possibly damaging 0.94
R1985:Pcnt UTSW 10 76380337 missense possibly damaging 0.95
R1995:Pcnt UTSW 10 76392799 nonsense probably null
R2073:Pcnt UTSW 10 76380380 missense possibly damaging 0.92
R2111:Pcnt UTSW 10 76420526 missense probably damaging 0.99
R2112:Pcnt UTSW 10 76420526 missense probably damaging 0.99
R2309:Pcnt UTSW 10 76442626 start gained probably benign
R2902:Pcnt UTSW 10 76375230 missense probably damaging 0.98
R3623:Pcnt UTSW 10 76433750 missense probably benign 0.23
R4088:Pcnt UTSW 10 76428014 missense probably damaging 1.00
R4300:Pcnt UTSW 10 76367391 missense probably benign 0.40
R4402:Pcnt UTSW 10 76392393 missense probably benign 0.00
R4407:Pcnt UTSW 10 76374870 missense possibly damaging 0.90
R4483:Pcnt UTSW 10 76401483 missense probably damaging 1.00
R4647:Pcnt UTSW 10 76354213 missense probably benign 0.01
R4734:Pcnt UTSW 10 76437206 missense probably benign 0.25
R4747:Pcnt UTSW 10 76436465 missense possibly damaging 0.91
R4782:Pcnt UTSW 10 76409577 missense possibly damaging 0.62
R4795:Pcnt UTSW 10 76370024 missense probably benign 0.21
R4831:Pcnt UTSW 10 76412501 missense probably damaging 0.96
R4873:Pcnt UTSW 10 76369854 missense probably benign 0.03
R4875:Pcnt UTSW 10 76369854 missense probably benign 0.03
R4946:Pcnt UTSW 10 76356185 missense probably damaging 1.00
R5032:Pcnt UTSW 10 76355077 missense probably benign 0.00
R5033:Pcnt UTSW 10 76399945 missense possibly damaging 0.95
R5106:Pcnt UTSW 10 76401444 missense probably damaging 1.00
R5118:Pcnt UTSW 10 76412168 missense probably damaging 0.98
R5167:Pcnt UTSW 10 76420424 missense probably damaging 0.97
R5199:Pcnt UTSW 10 76418544 missense probably benign 0.09
R5223:Pcnt UTSW 10 76380272 missense probably damaging 0.99
R5241:Pcnt UTSW 10 76433617 missense probably benign 0.26
R5308:Pcnt UTSW 10 76356325 nonsense probably null
R5328:Pcnt UTSW 10 76411719 missense probably damaging 1.00
R5454:Pcnt UTSW 10 76389547 splice site probably null
R5543:Pcnt UTSW 10 76412052 missense probably benign 0.01
R5588:Pcnt UTSW 10 76442611 missense possibly damaging 0.74
R5647:Pcnt UTSW 10 76385841 missense probably benign 0.17
R5668:Pcnt UTSW 10 76409500 missense probably benign 0.16
R5712:Pcnt UTSW 10 76429271 missense probably damaging 0.96
R5714:Pcnt UTSW 10 76420491 missense probably damaging 1.00
R5797:Pcnt UTSW 10 76392756 missense probably benign 0.00
R5946:Pcnt UTSW 10 76382063 missense possibly damaging 0.91
R5955:Pcnt UTSW 10 76411622 missense possibly damaging 0.45
R6024:Pcnt UTSW 10 76420037 missense possibly damaging 0.87
R6267:Pcnt UTSW 10 76385798 missense probably benign 0.02
R6485:Pcnt UTSW 10 76389330 nonsense probably null
R6605:Pcnt UTSW 10 76429198 critical splice donor site probably null
R6877:Pcnt UTSW 10 76434017 missense possibly damaging 0.94
R6882:Pcnt UTSW 10 76427828 missense probably benign 0.00
R6919:Pcnt UTSW 10 76385798 missense probably benign 0.02
R7025:Pcnt UTSW 10 76403835 missense probably damaging 1.00
R7098:Pcnt UTSW 10 76384839 missense probably benign
R7109:Pcnt UTSW 10 76369904 missense probably damaging 1.00
R7121:Pcnt UTSW 10 76427927 missense possibly damaging 0.73
R7152:Pcnt UTSW 10 76411360 intron probably null
R7213:Pcnt UTSW 10 76408904 missense probably damaging 1.00
R7368:Pcnt UTSW 10 76400001 missense probably benign
R7453:Pcnt UTSW 10 76389450 missense probably benign
R7486:Pcnt UTSW 10 76418436 missense probably benign 0.03
R7486:Pcnt UTSW 10 76418437 missense probably benign
R7538:Pcnt UTSW 10 76399939 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTCTGCAGCAGGGAGTAAG -3'
(R):5'- TGAAATGCCAGATTTCCCCACTC -3'

Sequencing Primer
(F):5'- ATGGTGCTTCCCAGCCGAG -3'
(R):5'- TCAAGAAAAGTTAACATCCCAAGGTG -3'
Posted On2019-05-15