Incidental Mutation 'R7144:Hmcn1'
ID553594
Institutional Source Beutler Lab
Gene Symbol Hmcn1
Ensembl Gene ENSMUSG00000066842
Gene Namehemicentin 1
SynonymsLOC240793, EG545370
Accession Numbers

Ncbi RefSeq: NM_001024720.3; MGI:2685047

Is this an essential gene? Possibly non essential (E-score: 0.291) question?
Stock #R7144 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location150562524-150993435 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 150663873 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 2956 (N2956D)
Ref Sequence ENSEMBL: ENSMUSP00000074340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074783] [ENSMUST00000137197]
Predicted Effect probably damaging
Transcript: ENSMUST00000074783
AA Change: N2956D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000074340
Gene: ENSMUSG00000066842
AA Change: N2956D

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 39 213 3e-1 SMART
IG_like 445 506 1.13e0 SMART
IGc2 532 598 2.32e-8 SMART
IGc2 624 688 1.24e-8 SMART
IGc2 714 779 7.52e-8 SMART
IGc2 805 874 2.19e-9 SMART
IGc2 902 967 5.15e-15 SMART
IGc2 993 1058 1.28e-10 SMART
IGc2 1092 1157 1.69e-10 SMART
IGc2 1183 1247 1.09e-13 SMART
IGc2 1278 1344 6.49e-12 SMART
IGc2 1372 1437 5.2e-11 SMART
IGc2 1465 1531 1.34e-13 SMART
IGc2 1559 1624 6.25e-14 SMART
IGc2 1653 1718 4.06e-13 SMART
IGc2 1746 1811 4.12e-14 SMART
IGc2 1838 1904 5.92e-15 SMART
IGc2 1932 1997 7.69e-14 SMART
IGc2 2023 2089 3.3e-13 SMART
IGc2 2115 2180 5e-13 SMART
IGc2 2208 2275 1.32e-12 SMART
IGc2 2304 2369 2.91e-14 SMART
IGc2 2398 2463 4e-12 SMART
IGc2 2491 2556 1.94e-19 SMART
IGc2 2587 2652 2.54e-14 SMART
IGc2 2686 2751 7.57e-13 SMART
IGc2 2789 2854 4.88e-16 SMART
IGc2 2884 2949 2.7e-9 SMART
IGc2 2976 3041 1.47e-10 SMART
IGc2 3071 3136 2.24e-15 SMART
IGc2 3163 3230 8.83e-14 SMART
IGc2 3258 3325 9.76e-16 SMART
IGc2 3354 3419 1.54e-13 SMART
IGc2 3447 3512 4.35e-13 SMART
IGc2 3540 3605 2e-12 SMART
IGc2 3633 3698 7.69e-14 SMART
IGc2 3724 3789 1.92e-14 SMART
IGc2 3815 3882 2.58e-6 SMART
IGc2 3908 3973 6.4e-11 SMART
IGc2 3999 4064 2.78e-11 SMART
IGc2 4090 4154 1.74e-12 SMART
low complexity region 4155 4160 N/A INTRINSIC
IGc2 4180 4245 3.35e-14 SMART
IGc2 4271 4334 8.12e-13 SMART
IGc2 4361 4425 1.79e-14 SMART
IGc2 4451 4515 1.06e-11 SMART
TSP1 4531 4583 4.72e-15 SMART
TSP1 4588 4640 2.39e-16 SMART
TSP1 4645 4697 1.67e-15 SMART
TSP1 4702 4754 2.2e-15 SMART
TSP1 4759 4811 2.77e-12 SMART
TSP1 4816 4868 2.67e-14 SMART
Pfam:G2F 4869 5051 1.5e-57 PFAM
EGF_CA 5106 5145 4.38e-11 SMART
EGF_CA 5146 5190 4.49e-8 SMART
EGF_CA 5191 5228 2.38e-12 SMART
EGF_CA 5229 5270 6.8e-8 SMART
EGF_CA 5271 5313 3.51e-10 SMART
EGF_CA 5314 5354 4.32e-10 SMART
low complexity region 5384 5400 N/A INTRINSIC
low complexity region 5401 5412 N/A INTRINSIC
EGF_CA 5431 5470 2.78e-13 SMART
EGF 5474 5516 1.44e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000137197
AA Change: N2956D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121500
Gene: ENSMUSG00000066842
AA Change: N2956D

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 39 213 3e-1 SMART
IG_like 445 506 1.13e0 SMART
IGc2 532 598 2.32e-8 SMART
IGc2 624 688 1.24e-8 SMART
IGc2 714 779 7.52e-8 SMART
IGc2 805 874 2.19e-9 SMART
IGc2 902 967 5.15e-15 SMART
IGc2 993 1058 1.28e-10 SMART
IGc2 1092 1157 1.69e-10 SMART
IGc2 1183 1247 1.09e-13 SMART
IGc2 1278 1344 6.49e-12 SMART
IGc2 1372 1437 5.2e-11 SMART
IGc2 1465 1531 1.34e-13 SMART
IGc2 1559 1624 6.25e-14 SMART
IGc2 1653 1718 4.06e-13 SMART
IGc2 1746 1811 4.12e-14 SMART
IGc2 1838 1904 5.92e-15 SMART
IGc2 1932 1997 7.69e-14 SMART
IGc2 2023 2089 3.3e-13 SMART
IGc2 2115 2180 5e-13 SMART
IGc2 2208 2275 1.32e-12 SMART
IGc2 2304 2369 2.91e-14 SMART
IGc2 2398 2463 4e-12 SMART
IGc2 2491 2556 1.94e-19 SMART
IGc2 2587 2652 2.54e-14 SMART
IGc2 2686 2751 7.57e-13 SMART
IGc2 2789 2854 4.88e-16 SMART
IGc2 2884 2949 2.7e-9 SMART
IGc2 2976 3041 1.47e-10 SMART
IGc2 3071 3136 2.24e-15 SMART
IGc2 3163 3230 8.83e-14 SMART
IGc2 3258 3325 9.76e-16 SMART
IGc2 3354 3419 1.54e-13 SMART
IGc2 3447 3512 4.35e-13 SMART
IGc2 3540 3605 2e-12 SMART
IGc2 3633 3698 7.69e-14 SMART
IGc2 3724 3789 1.92e-14 SMART
IGc2 3815 3882 2.58e-6 SMART
IGc2 3908 3973 6.4e-11 SMART
IGc2 3999 4064 2.78e-11 SMART
IGc2 4090 4154 1.74e-12 SMART
low complexity region 4155 4160 N/A INTRINSIC
IGc2 4180 4245 3.35e-14 SMART
IGc2 4271 4334 8.12e-13 SMART
IGc2 4361 4425 1.79e-14 SMART
IGc2 4451 4515 1.06e-11 SMART
TSP1 4531 4583 4.72e-15 SMART
TSP1 4588 4640 2.39e-16 SMART
TSP1 4645 4697 1.67e-15 SMART
TSP1 4702 4754 2.2e-15 SMART
TSP1 4759 4811 2.77e-12 SMART
TSP1 4816 4868 2.67e-14 SMART
PDB:1GL4|A 4869 5082 3e-6 PDB
SCOP:d1gl4a1 4869 5082 3e-79 SMART
EGF_CA 5106 5145 4.38e-11 SMART
EGF_CA 5146 5190 4.49e-8 SMART
EGF_CA 5191 5228 2.38e-12 SMART
EGF_CA 5229 5270 6.8e-8 SMART
EGF_CA 5271 5313 3.51e-10 SMART
EGF_CA 5314 5353 2.78e-13 SMART
EGF 5357 5399 1.44e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large extracellular member of the immunoglobulin superfamily. A similar protein in C. elegans forms long, fine tracks at specific extracellular sites that are involved in many processes such as stabilization of the germline syncytium, anchorage of mechanosensory neurons to the epidermis, and organization of hemidesmosomes in the epidermis. Mutations in this gene may be associated with age-related macular degeneration. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,433,573 I272F possibly damaging Het
Adcy10 G T 1: 165,510,370 M184I probably benign Het
Aldoa G T 7: 126,796,862 T124N possibly damaging Het
Ap4e1 T A 2: 127,011,807 I55N probably damaging Het
Arhgap21 T C 2: 20,865,387 T913A probably benign Het
Atrnl1 G A 19: 58,042,352 E1309K probably damaging Het
BC034090 A T 1: 155,242,031 C114S probably damaging Het
Brinp2 A G 1: 158,295,424 probably null Het
Ccna1 G T 3: 55,045,699 H408Q probably benign Het
Cd209g T G 8: 4,135,189 probably benign Het
Cdc20b A G 13: 113,083,371 I433V probably benign Het
Cdk2ap1 G A 5: 124,354,358 P5L probably damaging Het
Cep128 T C 12: 91,294,159 E310G probably damaging Het
Cflar G T 1: 58,753,848 V458F Het
Clec4b2 A G 6: 123,181,384 T70A probably benign Het
Cntnap5c A G 17: 58,286,888 T741A probably benign Het
Csf3r A T 4: 126,043,722 T800S probably benign Het
Csnk1g2 T C 10: 80,637,899 Y67H probably damaging Het
Cyp2c67 A T 19: 39,615,694 V406E probably benign Het
Dnah10 A G 5: 124,822,942 D3868G probably damaging Het
Dst A G 1: 34,152,243 N208S probably damaging Het
Echdc3 A G 2: 6,206,413 probably null Het
Edrf1 T C 7: 133,637,849 S13P probably benign Het
Ephb1 T C 9: 101,964,077 Y734C probably damaging Het
Eps8l1 A G 7: 4,472,185 Y325C probably damaging Het
Evc2 A G 5: 37,386,839 D644G probably damaging Het
Eya4 A C 10: 23,173,045 D54E probably benign Het
Filip1 T C 9: 79,820,213 S375G possibly damaging Het
Fmo9 A G 1: 166,677,620 M68T probably benign Het
Gemin5 G C 11: 58,141,663 P772A probably benign Het
Gle1 T G 2: 29,943,793 C401G probably damaging Het
Gm14548 A G 7: 3,897,616 V45A probably damaging Het
Gpr35 A C 1: 92,982,631 I22L probably benign Het
Grin2b T G 6: 135,733,476 D1024A possibly damaging Het
Htt T C 5: 34,846,006 L1275P probably damaging Het
Ibtk T C 9: 85,743,691 D2G probably benign Het
Il16 T A 7: 83,646,451 D1170V probably damaging Het
Iqgap3 T A 3: 88,116,910 I1513N probably damaging Het
Krt12 A T 11: 99,416,013 *488K probably null Het
Lap3 A T 5: 45,496,948 T83S probably benign Het
Lars2 T A 9: 123,431,993 S410T probably damaging Het
Limch1 A G 5: 67,017,658 T518A probably benign Het
Lrrc49 A T 9: 60,615,156 S381T probably damaging Het
Lrrk2 A G 15: 91,734,055 D919G possibly damaging Het
Mmp1a A T 9: 7,475,318 S363C probably damaging Het
Mrps22 A C 9: 98,601,471 probably null Het
Mybpc3 T C 2: 91,134,604 I1066T probably benign Het
Myo10 A T 15: 25,723,925 N215I probably damaging Het
Myocd A C 11: 65,218,648 L99R probably damaging Het
Nadk T G 4: 155,589,336 I394S probably damaging Het
Nadsyn1 T C 7: 143,811,215 N251S probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Ncapd2 G A 6: 125,176,670 P694L probably benign Het
Olfr1101 G T 2: 86,988,820 R119S probably damaging Het
Olfr1243 T C 2: 89,527,557 I284M probably damaging Het
Olfr317 A C 11: 58,732,745 L140R probably damaging Het
Olfr705 T A 7: 106,873,868 I126F probably damaging Het
Pcdhb13 T A 18: 37,443,256 I229K probably damaging Het
Pgbd5 A T 8: 124,374,317 M400K possibly damaging Het
Phactr3 A G 2: 178,302,736 N409S probably damaging Het
Pik3c2g C A 6: 139,629,870 P305Q probably damaging Het
Pik3r4 G A 9: 105,650,584 V379M probably damaging Het
Pkd1l2 A T 8: 117,076,131 C250* probably null Het
Pramef17 A C 4: 143,991,533 S447A probably benign Het
Rapgef6 A C 11: 54,657,365 T792P possibly damaging Het
Rexo5 A G 7: 119,805,191 D170G probably damaging Het
Sept11 A G 5: 93,156,866 I181V probably benign Het
Serpina1e T G 12: 103,947,018 *414C probably null Het
Serpine1 C A 5: 137,071,064 Q80H probably damaging Het
Sh3bp2 A G 5: 34,561,631 N560S probably benign Het
Slc25a25 A G 2: 32,419,166 F221S probably damaging Het
Sspn T C 6: 145,961,155 L104P probably damaging Het
St18 A C 1: 6,833,594 E693A probably damaging Het
St6galnac3 T C 3: 153,411,532 I185V possibly damaging Het
St8sia1 T C 6: 142,876,669 D156G probably damaging Het
Syne2 C A 12: 76,005,378 S4092R probably benign Het
Tll1 T A 8: 64,124,945 D76V possibly damaging Het
Tmco1 C T 1: 167,308,453 probably benign Het
Tnfaip3 T A 10: 19,007,281 T179S probably benign Het
Trav16 T C 14: 53,743,639 I95T possibly damaging Het
Trip12 A T 1: 84,793,714 S280T probably damaging Het
Unc79 A G 12: 103,142,626 M2166V probably benign Het
Vmn2r1 A G 3: 64,089,941 I339M probably damaging Het
Vwa5b1 A G 4: 138,605,431 probably null Het
Washc4 A T 10: 83,573,774 probably null Het
Wisp1 T A 15: 66,913,030 V184E probably damaging Het
Wiz A G 17: 32,357,628 S642P possibly damaging Het
Zeb2 T A 2: 45,110,041 K60N possibly damaging Het
Zfat T A 15: 68,178,782 T797S probably benign Het
Zfp74 T C 7: 29,935,165 K373E probably damaging Het
Zswim5 T C 4: 116,975,976 probably null Het
Other mutations in Hmcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Hmcn1 APN 1 150677278 missense probably benign
IGL00571:Hmcn1 APN 1 150638999 missense probably benign 0.05
IGL00726:Hmcn1 APN 1 150806366 critical splice donor site probably null
IGL00802:Hmcn1 APN 1 150664936 missense probably benign 0.19
IGL00824:Hmcn1 APN 1 150656734 missense probably damaging 1.00
IGL00834:Hmcn1 APN 1 150630340 missense probably benign 0.00
IGL00843:Hmcn1 APN 1 150610713 missense possibly damaging 0.95
IGL00845:Hmcn1 APN 1 150605006 missense probably damaging 0.98
IGL00851:Hmcn1 APN 1 150582301 missense probably benign 0.02
IGL00909:Hmcn1 APN 1 150638869 missense probably benign 0.12
IGL01074:Hmcn1 APN 1 150627033 missense possibly damaging 0.82
IGL01112:Hmcn1 APN 1 150632552 splice site probably benign
IGL01304:Hmcn1 APN 1 150622924 missense probably damaging 0.99
IGL01307:Hmcn1 APN 1 150745001 missense possibly damaging 0.84
IGL01318:Hmcn1 APN 1 150719240 missense probably damaging 1.00
IGL01403:Hmcn1 APN 1 150593097 missense probably damaging 1.00
IGL01417:Hmcn1 APN 1 150859239 missense probably damaging 1.00
IGL01503:Hmcn1 APN 1 150605072 missense probably benign 0.38
IGL01509:Hmcn1 APN 1 150609631 missense probably damaging 1.00
IGL01550:Hmcn1 APN 1 150598397 missense probably damaging 1.00
IGL01601:Hmcn1 APN 1 150627413 missense probably benign 0.01
IGL01617:Hmcn1 APN 1 150672032 missense probably benign 0.05
IGL01636:Hmcn1 APN 1 150580233 missense probably damaging 1.00
IGL01662:Hmcn1 APN 1 150737299 missense possibly damaging 0.46
IGL01693:Hmcn1 APN 1 150583280 missense probably damaging 1.00
IGL01723:Hmcn1 APN 1 150744960 missense probably benign 0.01
IGL01776:Hmcn1 APN 1 150672038 missense possibly damaging 0.70
IGL01783:Hmcn1 APN 1 150615300 missense possibly damaging 0.60
IGL01789:Hmcn1 APN 1 150690601 missense probably damaging 1.00
IGL01900:Hmcn1 APN 1 150742260 splice site probably benign
IGL01906:Hmcn1 APN 1 150667887 missense probably benign 0.01
IGL01947:Hmcn1 APN 1 150732892 missense possibly damaging 0.93
IGL01958:Hmcn1 APN 1 150603871 missense probably benign 0.01
IGL02002:Hmcn1 APN 1 150615298 missense probably damaging 1.00
IGL02058:Hmcn1 APN 1 150704181 missense probably benign 0.02
IGL02115:Hmcn1 APN 1 150630728 missense probably damaging 1.00
IGL02127:Hmcn1 APN 1 150722607 missense probably benign
IGL02155:Hmcn1 APN 1 150563598 missense probably damaging 1.00
IGL02222:Hmcn1 APN 1 150806401 missense probably benign 0.05
IGL02293:Hmcn1 APN 1 150664915 missense probably damaging 0.97
IGL02398:Hmcn1 APN 1 150802897 missense possibly damaging 0.78
IGL02420:Hmcn1 APN 1 150722424 missense probably damaging 1.00
IGL02553:Hmcn1 APN 1 150993023 missense probably benign 0.12
IGL02561:Hmcn1 APN 1 150809726 missense probably benign 0.32
IGL02569:Hmcn1 APN 1 150697493 missense probably benign 0.01
IGL02607:Hmcn1 APN 1 150744995 missense possibly damaging 0.88
IGL02676:Hmcn1 APN 1 150619009 missense probably benign 0.01
IGL02725:Hmcn1 APN 1 150604903 missense possibly damaging 0.92
IGL02726:Hmcn1 APN 1 150656694 nonsense probably null
IGL02735:Hmcn1 APN 1 150646832 missense probably benign 0.02
IGL02737:Hmcn1 APN 1 150563828 missense probably damaging 1.00
IGL02892:Hmcn1 APN 1 150675974 critical splice donor site probably null
IGL02927:Hmcn1 APN 1 150577278 missense probably damaging 1.00
IGL02931:Hmcn1 APN 1 150657207 missense probably benign 0.37
IGL02936:Hmcn1 APN 1 150697522 missense probably damaging 0.98
IGL02985:Hmcn1 APN 1 150671917 missense probably damaging 1.00
IGL03027:Hmcn1 APN 1 150808539 missense probably benign
IGL03195:Hmcn1 APN 1 150802909 missense probably benign 0.06
IGL03217:Hmcn1 APN 1 150743667 missense possibly damaging 0.58
IGL03232:Hmcn1 APN 1 150770352 splice site probably benign
IGL03268:Hmcn1 APN 1 150772510 missense probably damaging 1.00
IGL03271:Hmcn1 APN 1 150598424 missense possibly damaging 0.92
IGL03304:Hmcn1 APN 1 150630231 missense probably damaging 0.97
IGL03329:Hmcn1 APN 1 150732910 missense probably damaging 1.00
IGL03339:Hmcn1 APN 1 150701969 missense probably benign 0.04
IGL03368:Hmcn1 APN 1 150663872 missense probably damaging 1.00
backbone UTSW 1 150622994 missense probably benign 0.09
cambrian UTSW 1 150732846 missense probably damaging 1.00
chordate UTSW 1 150587015 missense probably benign 0.00
lancelet UTSW 1 150675540 missense probably benign 0.00
notochord UTSW 1 150770293 missense probably benign 0.00
IGL02991:Hmcn1 UTSW 1 150738658 missense possibly damaging 0.56
P0017:Hmcn1 UTSW 1 150720689 missense possibly damaging 0.49
PIT1430001:Hmcn1 UTSW 1 150808737 missense probably benign 0.00
PIT4514001:Hmcn1 UTSW 1 150669487 missense possibly damaging 0.93
R0006:Hmcn1 UTSW 1 150808676 missense probably damaging 0.99
R0018:Hmcn1 UTSW 1 150652551 missense probably benign 0.16
R0052:Hmcn1 UTSW 1 150677406 missense probably damaging 1.00
R0107:Hmcn1 UTSW 1 150587015 missense probably benign 0.00
R0115:Hmcn1 UTSW 1 150808647 missense possibly damaging 0.88
R0149:Hmcn1 UTSW 1 150677324 missense probably benign 0.00
R0152:Hmcn1 UTSW 1 150663879 missense probably benign 0.01
R0381:Hmcn1 UTSW 1 150603811 missense probably damaging 1.00
R0398:Hmcn1 UTSW 1 150798814 missense possibly damaging 0.83
R0414:Hmcn1 UTSW 1 150715822 missense possibly damaging 0.72
R0494:Hmcn1 UTSW 1 150732792 splice site probably benign
R0503:Hmcn1 UTSW 1 150859252 missense probably damaging 1.00
R0504:Hmcn1 UTSW 1 150876419 splice site probably benign
R0506:Hmcn1 UTSW 1 150742341 missense possibly damaging 0.69
R0554:Hmcn1 UTSW 1 150719117 missense probably benign 0.34
R0576:Hmcn1 UTSW 1 150650017 nonsense probably null
R0599:Hmcn1 UTSW 1 150609801 missense possibly damaging 0.91
R0605:Hmcn1 UTSW 1 150657376 critical splice donor site probably null
R0607:Hmcn1 UTSW 1 150638900 missense probably benign 0.01
R0620:Hmcn1 UTSW 1 150594016 missense probably benign 0.04
R0626:Hmcn1 UTSW 1 150798719 splice site probably null
R0699:Hmcn1 UTSW 1 150819410 missense probably damaging 1.00
R0765:Hmcn1 UTSW 1 150808787 missense probably damaging 1.00
R0782:Hmcn1 UTSW 1 150753665 missense possibly damaging 0.82
R0783:Hmcn1 UTSW 1 150650073 missense probably damaging 1.00
R0841:Hmcn1 UTSW 1 150679607 splice site probably null
R0975:Hmcn1 UTSW 1 150577377 missense probably benign 0.00
R1070:Hmcn1 UTSW 1 150689590 missense probably damaging 0.98
R1118:Hmcn1 UTSW 1 150618928 missense possibly damaging 0.56
R1119:Hmcn1 UTSW 1 150618928 missense possibly damaging 0.56
R1145:Hmcn1 UTSW 1 150679607 splice site probably null
R1145:Hmcn1 UTSW 1 150679607 splice site probably null
R1233:Hmcn1 UTSW 1 150749026 missense probably benign
R1234:Hmcn1 UTSW 1 150753654 nonsense probably null
R1291:Hmcn1 UTSW 1 150748191 missense probably damaging 1.00
R1334:Hmcn1 UTSW 1 150586468 missense possibly damaging 0.73
R1372:Hmcn1 UTSW 1 150680715 missense probably benign 0.22
R1424:Hmcn1 UTSW 1 150646794 missense probably benign 0.00
R1450:Hmcn1 UTSW 1 150652506 splice site probably benign
R1458:Hmcn1 UTSW 1 150609700 missense probably damaging 1.00
R1467:Hmcn1 UTSW 1 150689590 missense probably damaging 0.98
R1467:Hmcn1 UTSW 1 150689590 missense probably damaging 0.98
R1473:Hmcn1 UTSW 1 150772552 missense probably benign 0.03
R1517:Hmcn1 UTSW 1 150669421 missense probably damaging 1.00
R1527:Hmcn1 UTSW 1 150773803 missense probably benign 0.00
R1557:Hmcn1 UTSW 1 150734532 missense possibly damaging 0.86
R1576:Hmcn1 UTSW 1 150657241 missense possibly damaging 0.77
R1617:Hmcn1 UTSW 1 150745027 missense probably damaging 0.98
R1635:Hmcn1 UTSW 1 150669558 missense probably benign 0.00
R1655:Hmcn1 UTSW 1 150630333 missense probably benign 0.03
R1698:Hmcn1 UTSW 1 150565369 nonsense probably null
R1710:Hmcn1 UTSW 1 150675984 missense probably damaging 1.00
R1717:Hmcn1 UTSW 1 150859186 missense probably damaging 1.00
R1753:Hmcn1 UTSW 1 150586468 missense possibly damaging 0.73
R1756:Hmcn1 UTSW 1 150599030 missense probably damaging 1.00
R1772:Hmcn1 UTSW 1 150563568 missense probably damaging 0.99
R1793:Hmcn1 UTSW 1 150749083 missense probably benign 0.01
R1794:Hmcn1 UTSW 1 150598285 missense probably benign 0.00
R1794:Hmcn1 UTSW 1 150627152 missense probably damaging 0.98
R1856:Hmcn1 UTSW 1 150721664 missense probably benign 0.02
R1859:Hmcn1 UTSW 1 150657193 missense probably damaging 1.00
R1862:Hmcn1 UTSW 1 150638900 missense probably benign 0.01
R1865:Hmcn1 UTSW 1 150603812 missense probably damaging 1.00
R1874:Hmcn1 UTSW 1 150720695 missense probably damaging 1.00
R1880:Hmcn1 UTSW 1 150638900 missense probably benign 0.01
R1881:Hmcn1 UTSW 1 150638900 missense probably benign 0.01
R1886:Hmcn1 UTSW 1 150577295 missense probably benign 0.02
R1888:Hmcn1 UTSW 1 150819500 missense possibly damaging 0.82
R1888:Hmcn1 UTSW 1 150819500 missense possibly damaging 0.82
R1899:Hmcn1 UTSW 1 150657451 missense probably damaging 1.00
R1905:Hmcn1 UTSW 1 150992855 missense probably damaging 1.00
R1912:Hmcn1 UTSW 1 150604882 missense probably benign 0.28
R1959:Hmcn1 UTSW 1 150649676 missense probably benign 0.00
R1960:Hmcn1 UTSW 1 150675991 missense probably benign 0.00
R1960:Hmcn1 UTSW 1 150677376 missense possibly damaging 0.72
R2001:Hmcn1 UTSW 1 150738613 missense possibly damaging 0.81
R2011:Hmcn1 UTSW 1 150677334 missense probably benign 0.01
R2075:Hmcn1 UTSW 1 150577323 missense possibly damaging 0.86
R2136:Hmcn1 UTSW 1 150633659 missense probably damaging 1.00
R2192:Hmcn1 UTSW 1 150715815 missense probably damaging 0.97
R2267:Hmcn1 UTSW 1 150599010 missense probably benign 0.00
R2268:Hmcn1 UTSW 1 150624598 splice site probably benign
R2303:Hmcn1 UTSW 1 150704226 missense probably damaging 1.00
R2330:Hmcn1 UTSW 1 150652678 splice site probably benign
R2338:Hmcn1 UTSW 1 150622934 missense possibly damaging 0.89
R2380:Hmcn1 UTSW 1 150565384 missense probably benign 0.01
R2405:Hmcn1 UTSW 1 150860341 missense probably damaging 1.00
R2443:Hmcn1 UTSW 1 150599032 missense probably benign 0.01
R2496:Hmcn1 UTSW 1 150615221 missense probably benign 0.01
R2504:Hmcn1 UTSW 1 150686867 nonsense probably null
R2519:Hmcn1 UTSW 1 150773820 nonsense probably null
R2520:Hmcn1 UTSW 1 150743647 missense possibly damaging 0.72
R2679:Hmcn1 UTSW 1 150652575 missense possibly damaging 0.67
R2831:Hmcn1 UTSW 1 150630652 critical splice donor site probably null
R2847:Hmcn1 UTSW 1 150563599 nonsense probably null
R2849:Hmcn1 UTSW 1 150563599 nonsense probably null
R2869:Hmcn1 UTSW 1 150738716 missense possibly damaging 0.95
R2869:Hmcn1 UTSW 1 150738716 missense possibly damaging 0.95
R2871:Hmcn1 UTSW 1 150738716 missense possibly damaging 0.95
R2871:Hmcn1 UTSW 1 150738716 missense possibly damaging 0.95
R2872:Hmcn1 UTSW 1 150738716 missense possibly damaging 0.95
R2872:Hmcn1 UTSW 1 150738716 missense possibly damaging 0.95
R2873:Hmcn1 UTSW 1 150738716 missense possibly damaging 0.95
R2897:Hmcn1 UTSW 1 150802873 missense probably damaging 1.00
R2905:Hmcn1 UTSW 1 150749035 missense probably damaging 1.00
R3498:Hmcn1 UTSW 1 150605102 missense probably damaging 0.98
R3499:Hmcn1 UTSW 1 150605102 missense probably damaging 0.98
R3724:Hmcn1 UTSW 1 150689518 missense possibly damaging 0.82
R3765:Hmcn1 UTSW 1 150745025 missense possibly damaging 0.72
R3778:Hmcn1 UTSW 1 150802824 missense possibly damaging 0.95
R3790:Hmcn1 UTSW 1 150622994 missense probably benign 0.09
R3796:Hmcn1 UTSW 1 150586418 missense probably damaging 1.00
R3811:Hmcn1 UTSW 1 150649577 critical splice donor site probably null
R3825:Hmcn1 UTSW 1 150586965 missense probably benign 0.28
R3890:Hmcn1 UTSW 1 150635195 missense probably damaging 1.00
R3891:Hmcn1 UTSW 1 150635195 missense probably damaging 1.00
R3892:Hmcn1 UTSW 1 150635195 missense probably damaging 1.00
R3918:Hmcn1 UTSW 1 150690610 missense probably benign 0.00
R3964:Hmcn1 UTSW 1 150573569 missense probably benign 0.00
R4005:Hmcn1 UTSW 1 150722453 missense possibly damaging 0.88
R4026:Hmcn1 UTSW 1 150722369 missense probably benign 0.03
R4037:Hmcn1 UTSW 1 150772502 missense probably benign 0.00
R4088:Hmcn1 UTSW 1 150703216 missense possibly damaging 0.58
R4096:Hmcn1 UTSW 1 150658508 missense probably benign 0.20
R4169:Hmcn1 UTSW 1 150595999 splice site probably null
R4441:Hmcn1 UTSW 1 150657459 missense probably null
R4493:Hmcn1 UTSW 1 150701899 missense probably damaging 1.00
R4501:Hmcn1 UTSW 1 150633666 missense probably damaging 1.00
R4535:Hmcn1 UTSW 1 150563780 missense probably damaging 0.99
R4576:Hmcn1 UTSW 1 150734487 missense probably benign
R4601:Hmcn1 UTSW 1 150738645 missense probably damaging 0.99
R4627:Hmcn1 UTSW 1 150595894 missense probably benign 0.11
R4647:Hmcn1 UTSW 1 150675511 critical splice donor site probably null
R4657:Hmcn1 UTSW 1 150624550 missense probably damaging 1.00
R4717:Hmcn1 UTSW 1 150619065 missense probably benign 0.00
R4721:Hmcn1 UTSW 1 150772571 splice site probably null
R4724:Hmcn1 UTSW 1 150694833 splice site probably null
R4737:Hmcn1 UTSW 1 150689595 missense possibly damaging 0.90
R4744:Hmcn1 UTSW 1 150577612 missense probably damaging 1.00
R4795:Hmcn1 UTSW 1 150753611 missense probably benign 0.00
R4796:Hmcn1 UTSW 1 150753611 missense probably benign 0.00
R4871:Hmcn1 UTSW 1 150593085 missense probably benign 0.02
R4895:Hmcn1 UTSW 1 150677379 missense probably benign 0.00
R4934:Hmcn1 UTSW 1 150722535 missense probably damaging 1.00
R4953:Hmcn1 UTSW 1 150876360 intron probably benign
R4968:Hmcn1 UTSW 1 150657470 missense possibly damaging 0.67
R4974:Hmcn1 UTSW 1 150819449 missense probably benign 0.01
R5024:Hmcn1 UTSW 1 150680688 missense possibly damaging 0.65
R5031:Hmcn1 UTSW 1 150588257 missense probably damaging 1.00
R5093:Hmcn1 UTSW 1 150737256 missense probably benign 0.14
R5096:Hmcn1 UTSW 1 150610669 missense probably damaging 1.00
R5185:Hmcn1 UTSW 1 150656741 missense probably benign 0.03
R5228:Hmcn1 UTSW 1 150646701 missense probably benign 0.00
R5260:Hmcn1 UTSW 1 150595861 missense possibly damaging 0.65
R5264:Hmcn1 UTSW 1 150679514 missense probably benign 0.01
R5282:Hmcn1 UTSW 1 150582296 missense probably damaging 1.00
R5334:Hmcn1 UTSW 1 150755372 missense probably damaging 0.99
R5346:Hmcn1 UTSW 1 150623244 missense probably damaging 1.00
R5423:Hmcn1 UTSW 1 150701972 missense probably damaging 1.00
R5484:Hmcn1 UTSW 1 150675540 missense probably benign 0.00
R5491:Hmcn1 UTSW 1 150609825 splice site probably null
R5531:Hmcn1 UTSW 1 150743788 missense probably damaging 1.00
R5536:Hmcn1 UTSW 1 150755291 missense probably benign 0.01
R5547:Hmcn1 UTSW 1 150737506 missense possibly damaging 0.64
R5580:Hmcn1 UTSW 1 150577539 missense probably benign 0.43
R5626:Hmcn1 UTSW 1 150656567 missense probably damaging 1.00
R5657:Hmcn1 UTSW 1 150658562 missense probably benign 0.02
R5677:Hmcn1 UTSW 1 150609778 missense probably benign 0.00
R5718:Hmcn1 UTSW 1 150609666 missense probably damaging 1.00
R5718:Hmcn1 UTSW 1 150690600 nonsense probably null
R5723:Hmcn1 UTSW 1 150694849 missense possibly damaging 0.95
R5739:Hmcn1 UTSW 1 150758474 splice site probably null
R5739:Hmcn1 UTSW 1 150808697 missense probably benign 0.45
R5751:Hmcn1 UTSW 1 150573554 missense probably damaging 1.00
R5772:Hmcn1 UTSW 1 150694878 missense possibly damaging 0.47
R5804:Hmcn1 UTSW 1 150674347 nonsense probably null
R5809:Hmcn1 UTSW 1 150649607 missense probably damaging 1.00
R5817:Hmcn1 UTSW 1 150737524 missense possibly damaging 0.77
R5824:Hmcn1 UTSW 1 150993023 missense probably benign 0.12
R5881:Hmcn1 UTSW 1 150630327 missense probably damaging 0.99
R5928:Hmcn1 UTSW 1 150598897 missense possibly damaging 0.64
R5929:Hmcn1 UTSW 1 150577296 nonsense probably null
R5940:Hmcn1 UTSW 1 150657222 missense probably benign 0.41
R5973:Hmcn1 UTSW 1 150563817 missense probably damaging 1.00
R5997:Hmcn1 UTSW 1 150704173 missense possibly damaging 0.74
R6027:Hmcn1 UTSW 1 150802895 missense possibly damaging 0.79
R6029:Hmcn1 UTSW 1 150632437 missense probably benign 0.13
R6056:Hmcn1 UTSW 1 150663909 missense probably damaging 1.00
R6065:Hmcn1 UTSW 1 150770330 missense probably benign 0.06
R6083:Hmcn1 UTSW 1 150755293 missense probably damaging 1.00
R6083:Hmcn1 UTSW 1 150755294 missense probably damaging 1.00
R6108:Hmcn1 UTSW 1 150631227 missense possibly damaging 0.95
R6112:Hmcn1 UTSW 1 150618936 missense probably damaging 1.00
R6140:Hmcn1 UTSW 1 150732846 missense probably damaging 1.00
R6144:Hmcn1 UTSW 1 150722424 missense probably damaging 1.00
R6152:Hmcn1 UTSW 1 150565425 missense probably damaging 1.00
R6174:Hmcn1 UTSW 1 150646784 missense probably benign 0.06
R6185:Hmcn1 UTSW 1 150615438 intron probably null
R6187:Hmcn1 UTSW 1 150630728 missense probably damaging 1.00
R6276:Hmcn1 UTSW 1 150738681 missense possibly damaging 0.69
R6278:Hmcn1 UTSW 1 150697419 critical splice donor site probably null
R6427:Hmcn1 UTSW 1 150697476 missense possibly damaging 0.85
R6431:Hmcn1 UTSW 1 150744960 missense probably benign 0.01
R6441:Hmcn1 UTSW 1 150703216 missense possibly damaging 0.58
R6451:Hmcn1 UTSW 1 150992919 missense probably damaging 1.00
R6478:Hmcn1 UTSW 1 150664784 missense probably damaging 1.00
R6479:Hmcn1 UTSW 1 150677302 nonsense probably null
R6490:Hmcn1 UTSW 1 150583278 missense probably benign 0.00
R6525:Hmcn1 UTSW 1 150697566 missense probably damaging 1.00
R6571:Hmcn1 UTSW 1 150615438 intron probably null
R6612:Hmcn1 UTSW 1 150595118 critical splice donor site probably null
R6616:Hmcn1 UTSW 1 150723257 critical splice donor site probably null
R6617:Hmcn1 UTSW 1 150743796 missense probably benign 0.01
R6623:Hmcn1 UTSW 1 150758306 missense probably benign
R6687:Hmcn1 UTSW 1 150745033 missense probably benign 0.30
R6714:Hmcn1 UTSW 1 150704175 missense probably damaging 0.97
R6751:Hmcn1 UTSW 1 150734518 missense probably damaging 0.98
R6831:Hmcn1 UTSW 1 150770293 missense probably benign 0.00
R6971:Hmcn1 UTSW 1 150993051 start codon destroyed probably benign 0.00
R7048:Hmcn1 UTSW 1 150599653 critical splice acceptor site probably null
R7058:Hmcn1 UTSW 1 150773890 missense probably benign 0.43
R7071:Hmcn1 UTSW 1 150604102 missense probably damaging 1.00
R7078:Hmcn1 UTSW 1 150860367 missense probably damaging 1.00
R7092:Hmcn1 UTSW 1 150604246 missense probably damaging 1.00
R7120:Hmcn1 UTSW 1 150700541 missense probably damaging 0.98
R7148:Hmcn1 UTSW 1 150686854 missense probably benign 0.00
R7162:Hmcn1 UTSW 1 150748993 missense not run
R7172:Hmcn1 UTSW 1 150753699 missense not run
R7193:Hmcn1 UTSW 1 150649580 missense not run
R7231:Hmcn1 UTSW 1 150638876 missense not run
R7237:Hmcn1 UTSW 1 150722643 missense not run
R7258:Hmcn1 UTSW 1 150715823 missense not run
R7286:Hmcn1 UTSW 1 150582337 missense not run
R7289:Hmcn1 UTSW 1 150683715 missense not run
R7316:Hmcn1 UTSW 1 150732946 missense not run
X0022:Hmcn1 UTSW 1 150700530 missense probably benign 0.04
X0027:Hmcn1 UTSW 1 150860376 missense probably damaging 1.00
X0028:Hmcn1 UTSW 1 150663901 missense probably damaging 1.00
Z1088:Hmcn1 UTSW 1 150648937 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGTAAGAGACCCTCTGGCCTG -3'
(R):5'- TGCTCATCTGGCGTTTACTAG -3'

Sequencing Primer
(F):5'- AAAATGGGCTGTCTAGAAGATTTG -3'
(R):5'- GGCGTTTACTAGAAAGAATGCATCC -3'
Posted On2019-05-15