Incidental Mutation 'R7145:Nbeal1'
ID553682
Institutional Source Beutler Lab
Gene Symbol Nbeal1
Ensembl Gene ENSMUSG00000073664
Gene Nameneurobeachin like 1
SynonymsA530083I02Rik, A530050O19Rik, ALS2CR17, 2310076G13Rik
Accession Numbers

Genbank: NM_173444; MGI: 2444343

Is this an essential gene? Possibly non essential (E-score: 0.438) question?
Stock #R7145 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location60180599-60338328 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 60237151 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 684 (V684L)
Ref Sequence ENSEMBL: ENSMUSP00000124056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160834] [ENSMUST00000160980]
Predicted Effect probably benign
Transcript: ENSMUST00000160834
AA Change: V684L

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000124056
Gene: ENSMUSG00000073664
AA Change: V684L

DomainStartEndE-ValueType
low complexity region 522 541 N/A INTRINSIC
Pfam:Laminin_G_3 567 801 8.3e-9 PFAM
low complexity region 1383 1401 N/A INTRINSIC
low complexity region 1849 1865 N/A INTRINSIC
Pfam:PH_BEACH 1882 1975 4.9e-32 PFAM
Beach 1998 2278 7.2e-199 SMART
Blast:Beach 2342 2405 6e-30 BLAST
WD40 2425 2463 5.52e-2 SMART
WD40 2475 2514 4.95e-4 SMART
WD40 2604 2649 7.64e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160980
SMART Domains Protein: ENSMUSP00000125147
Gene: ENSMUSG00000073664

DomainStartEndE-ValueType
low complexity region 278 297 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI

All alleles(16) : Targeted(1) Gene trapped(15)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,070,059 Y1670H probably damaging Het
Abca12 T C 1: 71,307,053 K886R possibly damaging Het
Adcy3 G A 12: 4,200,992 E584K probably benign Het
Ano3 A T 2: 110,862,860 V131D probably benign Het
Arhgdig C T 17: 26,199,363 W215* probably null Het
Cad G T 5: 31,067,612 W953L possibly damaging Het
Calhm2 T C 19: 47,135,641 Y88C probably benign Het
Cdk5rap2 A T 4: 70,238,231 D1681E probably benign Het
Cenpl T A 1: 161,082,912 L143H possibly damaging Het
Cherp T C 8: 72,468,386 K270E Het
Cmss1 A G 16: 57,311,355 I136T probably benign Het
Col23a1 T C 11: 51,565,223 probably null Het
Crnn C A 3: 93,148,382 D158E probably damaging Het
Dnmt3a A T 12: 3,872,844 Q149L probably benign Het
Dst T A 1: 34,189,882 N2185K probably benign Het
Elp2 T A 18: 24,604,069 N25K probably benign Het
Ephb4 A T 5: 137,372,046 D845V probably damaging Het
Esyt3 T C 9: 99,319,574 T561A probably damaging Het
F3 G T 3: 121,731,586 V159L probably damaging Het
Fam81a A T 9: 70,110,278 D128E probably damaging Het
Flot1 T G 17: 35,824,943 H155Q probably benign Het
Fut9 T A 4: 25,620,507 K102N probably damaging Het
Gm16368 G T 12: 88,083,827 C44F probably benign Het
Gm6309 T C 5: 146,170,290 Q82R possibly damaging Het
H13 A G 2: 152,681,072 N102D probably damaging Het
Lamc2 C G 1: 153,130,772 A878P possibly damaging Het
Lepr C T 4: 101,752,197 T327I probably benign Het
Lrp2 A G 2: 69,454,808 probably null Het
Ly86 A G 13: 37,377,010 K116E probably damaging Het
Mapk8ip2 T A 15: 89,458,998 F648I possibly damaging Het
Muc16 G A 9: 18,655,580 T1881I unknown Het
Myh13 T G 11: 67,354,740 S1069A probably benign Het
Myh4 T A 11: 67,260,228 I1903N possibly damaging Het
Myo18b A T 5: 112,817,679 L1341* probably null Het
Naa25 G T 5: 121,417,489 probably null Het
Ncapg C T 5: 45,670,030 A3V possibly damaging Het
Ncln T C 10: 81,488,252 H481R probably benign Het
Nek4 C A 14: 30,982,348 Q607K probably damaging Het
Neo1 T C 9: 58,889,179 Y1182C probably damaging Het
Npnt T C 3: 132,909,931 N165S probably benign Het
Olfr1076 T C 2: 86,508,528 L23P probably damaging Het
Olfr1184 C T 2: 88,487,377 S215L probably damaging Het
Olfr145 A G 9: 37,897,563 H53R probably benign Het
Olfr167 C G 16: 19,514,899 V246L probably damaging Het
Otulin T C 15: 27,608,770 Y229C probably damaging Het
Palld A T 8: 61,532,017 D1071E unknown Het
Pcdhb20 T C 18: 37,505,089 S223P probably damaging Het
Pcdhga6 T A 18: 37,707,728 I167N probably damaging Het
Pcdhgb4 A G 18: 37,721,790 N413D probably benign Het
Pcdhgb8 T A 18: 37,762,997 Y373* probably null Het
Plxna2 G T 1: 194,649,522 V419L probably benign Het
Rpgrip1l A T 8: 91,232,806 probably null Het
Rsrc2 A G 5: 123,739,567 probably benign Het
Scaper C T 9: 55,912,111 D107N unknown Het
Scgb2b3 T A 7: 31,360,148 Y67F probably benign Het
Scn5a G A 9: 119,486,371 T1757I probably damaging Het
Sgo2b G A 8: 63,928,184 P538L probably damaging Het
Slc9a3 A G 13: 74,150,678 K72R probably damaging Het
Smchd1 T A 17: 71,378,207 T1409S probably benign Het
Stab1 A T 14: 31,145,073 probably null Het
Sult2b1 T C 7: 45,733,632 E242G probably damaging Het
Tcaf1 A T 6: 42,686,753 H64Q probably damaging Het
Tle6 T C 10: 81,600,076 T2A possibly damaging Het
Tmem115 T C 9: 107,535,086 V203A probably benign Het
Tmem45b G A 9: 31,429,041 T108I probably damaging Het
Tmf1 A T 6: 97,176,118 D331E probably damaging Het
Txndc9 T C 1: 37,990,296 Y157C probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r27 C A 6: 124,191,752 R806S probably benign Het
Vmn2r59 G A 7: 42,045,764 A408V probably damaging Het
Ythdc1 T C 5: 86,816,608 V92A probably benign Het
Other mutations in Nbeal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Nbeal1 APN 1 60235191 nonsense probably null 0.00
IGL00334:Nbeal1 APN 1 60281883 missense probably damaging 0.98
IGL00334:Nbeal1 APN 1 60328103 missense probably damaging 1.00
IGL00514:Nbeal1 APN 1 60217225 missense probably benign 0.31
IGL00596:Nbeal1 APN 1 60181741 missense probably damaging 0.96
IGL00654:Nbeal1 APN 1 60195011 critical splice acceptor site probably benign 0.00
IGL00757:Nbeal1 APN 1 60195143 missense possibly damaging 0.82
IGL00771:Nbeal1 APN 1 60235353 missense probably benign 0.11
IGL01315:Nbeal1 APN 1 60281341 missense probably damaging 1.00
IGL01445:Nbeal1 APN 1 60242625 critical splice donor site probably null
IGL01456:Nbeal1 APN 1 60230628 missense probably damaging 1.00
IGL01458:Nbeal1 APN 1 60242625 critical splice donor site probably null
IGL01535:Nbeal1 APN 1 60217255 missense probably damaging 1.00
IGL01608:Nbeal1 APN 1 60242535 critical splice acceptor site probably benign 0.00
IGL02006:Nbeal1 APN 1 60272259 critical splice donor site probably null
IGL02105:Nbeal1 APN 1 60253501 missense probably damaging 1.00
IGL02409:Nbeal1 APN 1 60329335 missense probably benign 0.01
IGL02713:Nbeal1 APN 1 60235237 missense possibly damaging 0.94
IGL02720:Nbeal1 APN 1 60283987 missense probably damaging 0.98
IGL02887:Nbeal1 APN 1 60287444 splice site probably benign
IGL02945:Nbeal1 APN 1 60206410 missense probably damaging 1.00
IGL03023:Nbeal1 APN 1 60253413 missense probably damaging 0.98
IGL03114:Nbeal1 APN 1 60278727 missense probably damaging 1.00
IGL03231:Nbeal1 APN 1 60236459 missense probably benign 0.44
IGL03241:Nbeal1 APN 1 60234868 missense possibly damaging 0.46
IGL03241:Nbeal1 APN 1 60234869 missense probably benign 0.44
IGL03382:Nbeal1 APN 1 60261586 critical splice donor site probably null
IGL03412:Nbeal1 APN 1 60242567 nonsense probably null
phainopepla UTSW 1 60319687 missense probably damaging 1.00
silky UTSW 1 60330878 splice site probably benign
3-1:Nbeal1 UTSW 1 60264272 splice site probably benign
P0007:Nbeal1 UTSW 1 60319688 missense probably damaging 0.98
P0028:Nbeal1 UTSW 1 60291937 missense probably damaging 1.00
R0041:Nbeal1 UTSW 1 60281871 missense probably benign 0.05
R0051:Nbeal1 UTSW 1 60310263 missense probably benign 0.19
R0052:Nbeal1 UTSW 1 60228612 splice site probably benign
R0054:Nbeal1 UTSW 1 60287401 utr 3 prime probably benign
R0062:Nbeal1 UTSW 1 60247717 missense probably benign 0.01
R0062:Nbeal1 UTSW 1 60247717 missense probably benign 0.01
R0094:Nbeal1 UTSW 1 60305309 missense possibly damaging 0.62
R0310:Nbeal1 UTSW 1 60305370 splice site probably benign
R0324:Nbeal1 UTSW 1 60292873 missense probably damaging 1.00
R0329:Nbeal1 UTSW 1 60268063 missense probably damaging 1.00
R0330:Nbeal1 UTSW 1 60268063 missense probably damaging 1.00
R0417:Nbeal1 UTSW 1 60247734 missense probably benign 0.00
R0421:Nbeal1 UTSW 1 60268439 missense probably benign 0.08
R0617:Nbeal1 UTSW 1 60281832 nonsense probably null
R1034:Nbeal1 UTSW 1 60290006 nonsense probably null
R1082:Nbeal1 UTSW 1 60312226 missense probably damaging 0.99
R1123:Nbeal1 UTSW 1 60260269 missense probably benign
R1187:Nbeal1 UTSW 1 60194528 missense probably damaging 1.00
R1484:Nbeal1 UTSW 1 60200939 missense probably damaging 1.00
R1594:Nbeal1 UTSW 1 60305291 missense possibly damaging 0.91
R1651:Nbeal1 UTSW 1 60200119 missense probably damaging 1.00
R1678:Nbeal1 UTSW 1 60260334 missense probably benign 0.00
R1806:Nbeal1 UTSW 1 60284092 missense probably damaging 1.00
R1937:Nbeal1 UTSW 1 60267941 nonsense probably null
R1952:Nbeal1 UTSW 1 60234840 missense probably damaging 1.00
R1953:Nbeal1 UTSW 1 60234840 missense probably damaging 1.00
R2038:Nbeal1 UTSW 1 60206344 missense probably benign 0.00
R2044:Nbeal1 UTSW 1 60319687 missense probably damaging 1.00
R2050:Nbeal1 UTSW 1 60292964 splice site probably null
R2055:Nbeal1 UTSW 1 60311057 missense probably damaging 1.00
R2064:Nbeal1 UTSW 1 60270356 missense possibly damaging 0.89
R2100:Nbeal1 UTSW 1 60305271 splice site probably null
R2181:Nbeal1 UTSW 1 60278780 missense probably damaging 1.00
R2192:Nbeal1 UTSW 1 60281895 missense probably damaging 1.00
R2203:Nbeal1 UTSW 1 60284006 missense probably benign 0.21
R2267:Nbeal1 UTSW 1 60330878 splice site probably benign
R2268:Nbeal1 UTSW 1 60330878 splice site probably benign
R2351:Nbeal1 UTSW 1 60237098 missense possibly damaging 0.90
R2366:Nbeal1 UTSW 1 60251352 missense probably damaging 0.97
R2393:Nbeal1 UTSW 1 60251370 missense probably damaging 0.98
R3545:Nbeal1 UTSW 1 60278780 missense probably damaging 1.00
R3546:Nbeal1 UTSW 1 60278780 missense probably damaging 1.00
R3547:Nbeal1 UTSW 1 60278780 missense probably damaging 1.00
R3701:Nbeal1 UTSW 1 60251413 splice site probably benign
R3747:Nbeal1 UTSW 1 60195023 missense probably damaging 0.98
R3875:Nbeal1 UTSW 1 60194599 splice site probably benign
R4119:Nbeal1 UTSW 1 60291870 missense probably damaging 0.99
R4256:Nbeal1 UTSW 1 60330948 missense probably benign 0.19
R4371:Nbeal1 UTSW 1 60289946 missense possibly damaging 0.95
R4450:Nbeal1 UTSW 1 60267774 missense probably damaging 0.97
R4558:Nbeal1 UTSW 1 60281310 nonsense probably null
R4618:Nbeal1 UTSW 1 60228731 intron probably benign
R4673:Nbeal1 UTSW 1 60329390 missense probably damaging 1.00
R4719:Nbeal1 UTSW 1 60235563 unclassified probably null
R4798:Nbeal1 UTSW 1 60222193 unclassified probably null
R4826:Nbeal1 UTSW 1 60251342 missense possibly damaging 0.79
R4841:Nbeal1 UTSW 1 60253375 missense probably damaging 1.00
R4842:Nbeal1 UTSW 1 60253375 missense probably damaging 1.00
R4895:Nbeal1 UTSW 1 60292903 missense probably damaging 1.00
R4929:Nbeal1 UTSW 1 60238654 missense probably damaging 1.00
R5026:Nbeal1 UTSW 1 60237179 missense probably damaging 1.00
R5243:Nbeal1 UTSW 1 60270328 missense probably damaging 0.99
R5300:Nbeal1 UTSW 1 60235559 nonsense probably null
R5345:Nbeal1 UTSW 1 60328210 critical splice donor site probably null
R5502:Nbeal1 UTSW 1 60310999 missense probably damaging 1.00
R5542:Nbeal1 UTSW 1 60277194 missense probably benign 0.00
R5555:Nbeal1 UTSW 1 60237152 missense possibly damaging 0.93
R5580:Nbeal1 UTSW 1 60242602 missense probably benign 0.45
R5765:Nbeal1 UTSW 1 60291847 missense probably damaging 1.00
R5802:Nbeal1 UTSW 1 60272221 missense probably benign 0.01
R5907:Nbeal1 UTSW 1 60228791 intron probably benign
R5918:Nbeal1 UTSW 1 60267892 missense possibly damaging 0.90
R5923:Nbeal1 UTSW 1 60248395 missense probably damaging 1.00
R6066:Nbeal1 UTSW 1 60248405 missense probably benign 0.29
R6091:Nbeal1 UTSW 1 60181556 start gained probably benign
R6113:Nbeal1 UTSW 1 60222263 missense possibly damaging 0.95
R6143:Nbeal1 UTSW 1 60251307 missense possibly damaging 0.81
R6194:Nbeal1 UTSW 1 60257484 missense possibly damaging 0.80
R6197:Nbeal1 UTSW 1 60222128 missense probably damaging 0.99
R6228:Nbeal1 UTSW 1 60295924 missense probably benign 0.00
R6229:Nbeal1 UTSW 1 60248365 missense possibly damaging 0.88
R6309:Nbeal1 UTSW 1 60238719 missense probably benign
R6457:Nbeal1 UTSW 1 60253474 missense probably benign 0.31
R6489:Nbeal1 UTSW 1 60330942 missense possibly damaging 0.89
R6845:Nbeal1 UTSW 1 60281310 nonsense probably null
R7021:Nbeal1 UTSW 1 60261586 critical splice donor site probably null
R7033:Nbeal1 UTSW 1 60310947 missense probably damaging 1.00
R7144:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7146:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7157:Nbeal1 UTSW 1 60237158 missense probably damaging 1.00
R7157:Nbeal1 UTSW 1 60260634 nonsense probably null
R7209:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7210:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7211:Nbeal1 UTSW 1 60200951 missense probably damaging 1.00
R7212:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7213:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7214:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7283:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7285:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7287:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7312:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7313:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
X0022:Nbeal1 UTSW 1 60277232 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATCTTTGAAGATTTCCTAGGCTGG -3'
(R):5'- TGCTGAACCTACTTCTCCAAAC -3'

Sequencing Primer
(F):5'- TGTTAAACCAGTTATCTCTGTTGC -3'
(R):5'- ACATCTGAAATTATCTAATGGCAGAC -3'
Posted On2019-05-15