Incidental Mutation 'R7145:Ythdc1'
ID553701
Institutional Source Beutler Lab
Gene Symbol Ythdc1
Ensembl Gene ENSMUSG00000035851
Gene NameYTH domain containing 1
SynonymsA730098D12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R7145 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location86804221-86836659 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86816608 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 92 (V92A)
Ref Sequence ENSEMBL: ENSMUSP00000113951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038384] [ENSMUST00000119339] [ENSMUST00000120498] [ENSMUST00000156363]
Predicted Effect probably benign
Transcript: ENSMUST00000038384
AA Change: V92A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000039133
Gene: ENSMUSG00000035851
AA Change: V92A

DomainStartEndE-ValueType
SCOP:d1qbkb_ 225 249 6e-3 SMART
low complexity region 269 280 N/A INTRINSIC
low complexity region 316 330 N/A INTRINSIC
Pfam:YTH 356 494 5e-42 PFAM
low complexity region 516 540 N/A INTRINSIC
low complexity region 609 622 N/A INTRINSIC
low complexity region 625 645 N/A INTRINSIC
low complexity region 682 736 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119339
AA Change: V92A

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000113000
Gene: ENSMUSG00000035851
AA Change: V92A

DomainStartEndE-ValueType
SCOP:d1qbkb_ 225 249 6e-3 SMART
low complexity region 269 280 N/A INTRINSIC
Pfam:YTH 337 478 4.4e-44 PFAM
low complexity region 498 522 N/A INTRINSIC
low complexity region 583 596 N/A INTRINSIC
low complexity region 599 619 N/A INTRINSIC
low complexity region 656 710 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120498
AA Change: V92A

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000113951
Gene: ENSMUSG00000035851
AA Change: V92A

DomainStartEndE-ValueType
SCOP:d1qbkb_ 225 249 6e-3 SMART
low complexity region 269 280 N/A INTRINSIC
low complexity region 316 330 N/A INTRINSIC
Pfam:YTH 355 496 4.6e-44 PFAM
low complexity region 516 540 N/A INTRINSIC
low complexity region 601 614 N/A INTRINSIC
low complexity region 617 637 N/A INTRINSIC
low complexity region 674 728 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151489
Predicted Effect probably benign
Transcript: ENSMUST00000156363
AA Change: V104A

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000122491
Gene: ENSMUSG00000035851
AA Change: V104A

DomainStartEndE-ValueType
SCOP:d1qbkb_ 237 261 8e-3 SMART
low complexity region 281 292 N/A INTRINSIC
Pfam:YTH 350 488 3e-42 PFAM
low complexity region 510 525 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198859
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,070,059 Y1670H probably damaging Het
Abca12 T C 1: 71,307,053 K886R possibly damaging Het
Adcy3 G A 12: 4,200,992 E584K probably benign Het
Ano3 A T 2: 110,862,860 V131D probably benign Het
Arhgdig C T 17: 26,199,363 W215* probably null Het
Cad G T 5: 31,067,612 W953L possibly damaging Het
Calhm2 T C 19: 47,135,641 Y88C probably benign Het
Cdk5rap2 A T 4: 70,238,231 D1681E probably benign Het
Cenpl T A 1: 161,082,912 L143H possibly damaging Het
Cherp T C 8: 72,468,386 K270E Het
Cmss1 A G 16: 57,311,355 I136T probably benign Het
Col23a1 T C 11: 51,565,223 probably null Het
Crnn C A 3: 93,148,382 D158E probably damaging Het
Dnmt3a A T 12: 3,872,844 Q149L probably benign Het
Dst T A 1: 34,189,882 N2185K probably benign Het
Elp2 T A 18: 24,604,069 N25K probably benign Het
Ephb4 A T 5: 137,372,046 D845V probably damaging Het
Esyt3 T C 9: 99,319,574 T561A probably damaging Het
F3 G T 3: 121,731,586 V159L probably damaging Het
Fam81a A T 9: 70,110,278 D128E probably damaging Het
Flot1 T G 17: 35,824,943 H155Q probably benign Het
Fut9 T A 4: 25,620,507 K102N probably damaging Het
Gm16368 G T 12: 88,083,827 C44F probably benign Het
Gm6309 T C 5: 146,170,290 Q82R possibly damaging Het
H13 A G 2: 152,681,072 N102D probably damaging Het
Lamc2 C G 1: 153,130,772 A878P possibly damaging Het
Lepr C T 4: 101,752,197 T327I probably benign Het
Lrp2 A G 2: 69,454,808 probably null Het
Ly86 A G 13: 37,377,010 K116E probably damaging Het
Mapk8ip2 T A 15: 89,458,998 F648I possibly damaging Het
Muc16 G A 9: 18,655,580 T1881I unknown Het
Myh13 T G 11: 67,354,740 S1069A probably benign Het
Myh4 T A 11: 67,260,228 I1903N possibly damaging Het
Myo18b A T 5: 112,817,679 L1341* probably null Het
Naa25 G T 5: 121,417,489 probably null Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Ncapg C T 5: 45,670,030 A3V possibly damaging Het
Ncln T C 10: 81,488,252 H481R probably benign Het
Nek4 C A 14: 30,982,348 Q607K probably damaging Het
Neo1 T C 9: 58,889,179 Y1182C probably damaging Het
Npnt T C 3: 132,909,931 N165S probably benign Het
Olfr1076 T C 2: 86,508,528 L23P probably damaging Het
Olfr1184 C T 2: 88,487,377 S215L probably damaging Het
Olfr145 A G 9: 37,897,563 H53R probably benign Het
Olfr167 C G 16: 19,514,899 V246L probably damaging Het
Otulin T C 15: 27,608,770 Y229C probably damaging Het
Palld A T 8: 61,532,017 D1071E unknown Het
Pcdhb20 T C 18: 37,505,089 S223P probably damaging Het
Pcdhga6 T A 18: 37,707,728 I167N probably damaging Het
Pcdhgb4 A G 18: 37,721,790 N413D probably benign Het
Pcdhgb8 T A 18: 37,762,997 Y373* probably null Het
Plxna2 G T 1: 194,649,522 V419L probably benign Het
Rpgrip1l A T 8: 91,232,806 probably null Het
Rsrc2 A G 5: 123,739,567 probably benign Het
Scaper C T 9: 55,912,111 D107N unknown Het
Scgb2b3 T A 7: 31,360,148 Y67F probably benign Het
Scn5a G A 9: 119,486,371 T1757I probably damaging Het
Sgo2b G A 8: 63,928,184 P538L probably damaging Het
Slc9a3 A G 13: 74,150,678 K72R probably damaging Het
Smchd1 T A 17: 71,378,207 T1409S probably benign Het
Stab1 A T 14: 31,145,073 probably null Het
Sult2b1 T C 7: 45,733,632 E242G probably damaging Het
Tcaf1 A T 6: 42,686,753 H64Q probably damaging Het
Tle6 T C 10: 81,600,076 T2A possibly damaging Het
Tmem115 T C 9: 107,535,086 V203A probably benign Het
Tmem45b G A 9: 31,429,041 T108I probably damaging Het
Tmf1 A T 6: 97,176,118 D331E probably damaging Het
Txndc9 T C 1: 37,990,296 Y157C probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r27 C A 6: 124,191,752 R806S probably benign Het
Vmn2r59 G A 7: 42,045,764 A408V probably damaging Het
Other mutations in Ythdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00676:Ythdc1 APN 5 86831811 missense probably damaging 1.00
IGL02222:Ythdc1 APN 5 86828043 missense possibly damaging 0.72
R0091:Ythdc1 UTSW 5 86820701 intron probably benign
R0311:Ythdc1 UTSW 5 86835705 missense probably damaging 0.97
R0349:Ythdc1 UTSW 5 86835720 missense probably damaging 1.00
R0630:Ythdc1 UTSW 5 86809348 splice site probably benign
R1662:Ythdc1 UTSW 5 86828122 critical splice donor site probably null
R1907:Ythdc1 UTSW 5 86830630 missense probably damaging 1.00
R2100:Ythdc1 UTSW 5 86816685 missense possibly damaging 0.62
R2911:Ythdc1 UTSW 5 86816559 missense possibly damaging 0.95
R3692:Ythdc1 UTSW 5 86822667 missense probably damaging 0.98
R4042:Ythdc1 UTSW 5 86816524 missense probably benign 0.03
R4398:Ythdc1 UTSW 5 86815654 missense possibly damaging 0.95
R4398:Ythdc1 UTSW 5 86835820 utr 3 prime probably benign
R4608:Ythdc1 UTSW 5 86822808 missense probably damaging 0.97
R4806:Ythdc1 UTSW 5 86822845 missense probably damaging 0.99
R5291:Ythdc1 UTSW 5 86835688 missense probably damaging 1.00
R5761:Ythdc1 UTSW 5 86835951 utr 3 prime probably benign
R6180:Ythdc1 UTSW 5 86828094 missense possibly damaging 0.91
R6249:Ythdc1 UTSW 5 86831956 missense possibly damaging 0.94
R6560:Ythdc1 UTSW 5 86816608 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TTAGTTCAGCAGTTGGGAAGC -3'
(R):5'- TGTAGGAGACTTGGCCCTTC -3'

Sequencing Primer
(F):5'- CAGCAGTTGGGAAGCAGTTTTG -3'
(R):5'- AGGAGACTTGGCCCTTCTTTCAG -3'
Posted On2019-05-15