Incidental Mutation 'R7145:Olfr145'
ID553719
Institutional Source Beutler Lab
Gene Symbol Olfr145
Ensembl Gene ENSMUSG00000066748
Gene Nameolfactory receptor 145
SynonymsK21, MOR161-6, GA_x6K02T2PVTD-31578734-31579666
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R7145 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location37896724-37903519 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37897563 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 53 (H53R)
Ref Sequence ENSEMBL: ENSMUSP00000150284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086062] [ENSMUST00000213688]
Predicted Effect probably benign
Transcript: ENSMUST00000086062
AA Change: H53R

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000083229
Gene: ENSMUSG00000066748
AA Change: H53R

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 4e-51 PFAM
Pfam:7tm_1 40 289 1.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213688
AA Change: H53R

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,070,059 Y1670H probably damaging Het
Abca12 T C 1: 71,307,053 K886R possibly damaging Het
Adcy3 G A 12: 4,200,992 E584K probably benign Het
Ano3 A T 2: 110,862,860 V131D probably benign Het
Arhgdig C T 17: 26,199,363 W215* probably null Het
Cad G T 5: 31,067,612 W953L possibly damaging Het
Calhm2 T C 19: 47,135,641 Y88C probably benign Het
Cdk5rap2 A T 4: 70,238,231 D1681E probably benign Het
Cenpl T A 1: 161,082,912 L143H possibly damaging Het
Cherp T C 8: 72,468,386 K270E Het
Cmss1 A G 16: 57,311,355 I136T probably benign Het
Col23a1 T C 11: 51,565,223 probably null Het
Crnn C A 3: 93,148,382 D158E probably damaging Het
Dnmt3a A T 12: 3,872,844 Q149L probably benign Het
Dst T A 1: 34,189,882 N2185K probably benign Het
Elp2 T A 18: 24,604,069 N25K probably benign Het
Ephb4 A T 5: 137,372,046 D845V probably damaging Het
Esyt3 T C 9: 99,319,574 T561A probably damaging Het
F3 G T 3: 121,731,586 V159L probably damaging Het
Fam81a A T 9: 70,110,278 D128E probably damaging Het
Flot1 T G 17: 35,824,943 H155Q probably benign Het
Fut9 T A 4: 25,620,507 K102N probably damaging Het
Gm16368 G T 12: 88,083,827 C44F probably benign Het
Gm6309 T C 5: 146,170,290 Q82R possibly damaging Het
H13 A G 2: 152,681,072 N102D probably damaging Het
Lamc2 C G 1: 153,130,772 A878P possibly damaging Het
Lepr C T 4: 101,752,197 T327I probably benign Het
Lrp2 A G 2: 69,454,808 probably null Het
Ly86 A G 13: 37,377,010 K116E probably damaging Het
Mapk8ip2 T A 15: 89,458,998 F648I possibly damaging Het
Muc16 G A 9: 18,655,580 T1881I unknown Het
Myh13 T G 11: 67,354,740 S1069A probably benign Het
Myh4 T A 11: 67,260,228 I1903N possibly damaging Het
Myo18b A T 5: 112,817,679 L1341* probably null Het
Naa25 G T 5: 121,417,489 probably null Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Ncapg C T 5: 45,670,030 A3V possibly damaging Het
Ncln T C 10: 81,488,252 H481R probably benign Het
Nek4 C A 14: 30,982,348 Q607K probably damaging Het
Neo1 T C 9: 58,889,179 Y1182C probably damaging Het
Npnt T C 3: 132,909,931 N165S probably benign Het
Olfr1076 T C 2: 86,508,528 L23P probably damaging Het
Olfr1184 C T 2: 88,487,377 S215L probably damaging Het
Olfr167 C G 16: 19,514,899 V246L probably damaging Het
Otulin T C 15: 27,608,770 Y229C probably damaging Het
Palld A T 8: 61,532,017 D1071E unknown Het
Pcdhb20 T C 18: 37,505,089 S223P probably damaging Het
Pcdhga6 T A 18: 37,707,728 I167N probably damaging Het
Pcdhgb4 A G 18: 37,721,790 N413D probably benign Het
Pcdhgb8 T A 18: 37,762,997 Y373* probably null Het
Plxna2 G T 1: 194,649,522 V419L probably benign Het
Rpgrip1l A T 8: 91,232,806 probably null Het
Rsrc2 A G 5: 123,739,567 probably benign Het
Scaper C T 9: 55,912,111 D107N unknown Het
Scgb2b3 T A 7: 31,360,148 Y67F probably benign Het
Scn5a G A 9: 119,486,371 T1757I probably damaging Het
Sgo2b G A 8: 63,928,184 P538L probably damaging Het
Slc9a3 A G 13: 74,150,678 K72R probably damaging Het
Smchd1 T A 17: 71,378,207 T1409S probably benign Het
Stab1 A T 14: 31,145,073 probably null Het
Sult2b1 T C 7: 45,733,632 E242G probably damaging Het
Tcaf1 A T 6: 42,686,753 H64Q probably damaging Het
Tle6 T C 10: 81,600,076 T2A possibly damaging Het
Tmem115 T C 9: 107,535,086 V203A probably benign Het
Tmem45b G A 9: 31,429,041 T108I probably damaging Het
Tmf1 A T 6: 97,176,118 D331E probably damaging Het
Txndc9 T C 1: 37,990,296 Y157C probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r27 C A 6: 124,191,752 R806S probably benign Het
Vmn2r59 G A 7: 42,045,764 A408V probably damaging Het
Ythdc1 T C 5: 86,816,608 V92A probably benign Het
Other mutations in Olfr145
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Olfr145 APN 9 37898063 missense probably benign 0.13
IGL01586:Olfr145 APN 9 37897976 missense possibly damaging 0.73
IGL02185:Olfr145 APN 9 37898235 missense probably damaging 1.00
IGL02895:Olfr145 APN 9 37897982 missense probably benign 0.01
IGL02956:Olfr145 APN 9 37898108 missense probably damaging 1.00
R0391:Olfr145 UTSW 9 37897842 missense probably benign 0.31
R0513:Olfr145 UTSW 9 37898055 missense probably damaging 1.00
R4600:Olfr145 UTSW 9 37898326 missense probably benign
R4610:Olfr145 UTSW 9 37898326 missense probably benign
R4611:Olfr145 UTSW 9 37898326 missense probably benign
R4982:Olfr145 UTSW 9 37897515 missense probably damaging 1.00
R5574:Olfr145 UTSW 9 37897581 missense probably damaging 1.00
R5608:Olfr145 UTSW 9 37897782 missense probably damaging 0.98
R5688:Olfr145 UTSW 9 37898063 missense possibly damaging 0.91
R5906:Olfr145 UTSW 9 37897878 missense probably damaging 1.00
R6286:Olfr145 UTSW 9 37897778 missense probably damaging 0.99
R7138:Olfr145 UTSW 9 37898064 missense probably damaging 0.99
X0012:Olfr145 UTSW 9 37898328 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AATGCTGTGAGGATGGCCAC -3'
(R):5'- ACATCAGAGGATTACAGATGGCAAC -3'

Sequencing Primer
(F):5'- GATGGCCACTGAAAATGCCTCTG -3'
(R):5'- ACCTGTCATATGCCATTGCTGATAGG -3'
Posted On2019-05-15