Incidental Mutation 'R7145:Tmem115'
ID553724
Institutional Source Beutler Lab
Gene Symbol Tmem115
Ensembl Gene ENSMUSG00000010045
Gene Nametransmembrane protein 115
SynonymsPl6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock #R7145 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location107533945-107538673 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107535086 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 203 (V203A)
Ref Sequence ENSEMBL: ENSMUSP00000010189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010189] [ENSMUST00000041459] [ENSMUST00000194967] [ENSMUST00000195235]
Predicted Effect probably benign
Transcript: ENSMUST00000010189
AA Change: V203A

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000010189
Gene: ENSMUSG00000010045
AA Change: V203A

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
DUF1751 49 151 4.14e-41 SMART
transmembrane domain 164 183 N/A INTRINSIC
transmembrane domain 190 208 N/A INTRINSIC
transmembrane domain 223 245 N/A INTRINSIC
Blast:DUF1751 304 347 2e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000041459
SMART Domains Protein: ENSMUSP00000044093
Gene: ENSMUSG00000037190

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
B561 47 178 8.01e-42 SMART
transmembrane domain 189 211 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194344
Predicted Effect probably benign
Transcript: ENSMUST00000194967
Predicted Effect probably benign
Transcript: ENSMUST00000195235
SMART Domains Protein: ENSMUSP00000141723
Gene: ENSMUSG00000037190

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
B561 47 178 8.01e-42 SMART
transmembrane domain 189 211 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,070,059 Y1670H probably damaging Het
Abca12 T C 1: 71,307,053 K886R possibly damaging Het
Adcy3 G A 12: 4,200,992 E584K probably benign Het
Ano3 A T 2: 110,862,860 V131D probably benign Het
Arhgdig C T 17: 26,199,363 W215* probably null Het
Cad G T 5: 31,067,612 W953L possibly damaging Het
Calhm2 T C 19: 47,135,641 Y88C probably benign Het
Cdk5rap2 A T 4: 70,238,231 D1681E probably benign Het
Cenpl T A 1: 161,082,912 L143H possibly damaging Het
Cherp T C 8: 72,468,386 K270E Het
Cmss1 A G 16: 57,311,355 I136T probably benign Het
Col23a1 T C 11: 51,565,223 probably null Het
Crnn C A 3: 93,148,382 D158E probably damaging Het
Dnmt3a A T 12: 3,872,844 Q149L probably benign Het
Dst T A 1: 34,189,882 N2185K probably benign Het
Elp2 T A 18: 24,604,069 N25K probably benign Het
Ephb4 A T 5: 137,372,046 D845V probably damaging Het
Esyt3 T C 9: 99,319,574 T561A probably damaging Het
F3 G T 3: 121,731,586 V159L probably damaging Het
Fam81a A T 9: 70,110,278 D128E probably damaging Het
Flot1 T G 17: 35,824,943 H155Q probably benign Het
Fut9 T A 4: 25,620,507 K102N probably damaging Het
Gm16368 G T 12: 88,083,827 C44F probably benign Het
Gm6309 T C 5: 146,170,290 Q82R possibly damaging Het
H13 A G 2: 152,681,072 N102D probably damaging Het
Lamc2 C G 1: 153,130,772 A878P possibly damaging Het
Lepr C T 4: 101,752,197 T327I probably benign Het
Lrp2 A G 2: 69,454,808 probably null Het
Ly86 A G 13: 37,377,010 K116E probably damaging Het
Mapk8ip2 T A 15: 89,458,998 F648I possibly damaging Het
Muc16 G A 9: 18,655,580 T1881I unknown Het
Myh13 T G 11: 67,354,740 S1069A probably benign Het
Myh4 T A 11: 67,260,228 I1903N possibly damaging Het
Myo18b A T 5: 112,817,679 L1341* probably null Het
Naa25 G T 5: 121,417,489 probably null Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Ncapg C T 5: 45,670,030 A3V possibly damaging Het
Ncln T C 10: 81,488,252 H481R probably benign Het
Nek4 C A 14: 30,982,348 Q607K probably damaging Het
Neo1 T C 9: 58,889,179 Y1182C probably damaging Het
Npnt T C 3: 132,909,931 N165S probably benign Het
Olfr1076 T C 2: 86,508,528 L23P probably damaging Het
Olfr1184 C T 2: 88,487,377 S215L probably damaging Het
Olfr145 A G 9: 37,897,563 H53R probably benign Het
Olfr167 C G 16: 19,514,899 V246L probably damaging Het
Otulin T C 15: 27,608,770 Y229C probably damaging Het
Palld A T 8: 61,532,017 D1071E unknown Het
Pcdhb20 T C 18: 37,505,089 S223P probably damaging Het
Pcdhga6 T A 18: 37,707,728 I167N probably damaging Het
Pcdhgb4 A G 18: 37,721,790 N413D probably benign Het
Pcdhgb8 T A 18: 37,762,997 Y373* probably null Het
Plxna2 G T 1: 194,649,522 V419L probably benign Het
Rpgrip1l A T 8: 91,232,806 probably null Het
Rsrc2 A G 5: 123,739,567 probably benign Het
Scaper C T 9: 55,912,111 D107N unknown Het
Scgb2b3 T A 7: 31,360,148 Y67F probably benign Het
Scn5a G A 9: 119,486,371 T1757I probably damaging Het
Sgo2b G A 8: 63,928,184 P538L probably damaging Het
Slc9a3 A G 13: 74,150,678 K72R probably damaging Het
Smchd1 T A 17: 71,378,207 T1409S probably benign Het
Stab1 A T 14: 31,145,073 probably null Het
Sult2b1 T C 7: 45,733,632 E242G probably damaging Het
Tcaf1 A T 6: 42,686,753 H64Q probably damaging Het
Tle6 T C 10: 81,600,076 T2A possibly damaging Het
Tmem45b G A 9: 31,429,041 T108I probably damaging Het
Tmf1 A T 6: 97,176,118 D331E probably damaging Het
Txndc9 T C 1: 37,990,296 Y157C probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r27 C A 6: 124,191,752 R806S probably benign Het
Vmn2r59 G A 7: 42,045,764 A408V probably damaging Het
Ythdc1 T C 5: 86,816,608 V92A probably benign Het
Other mutations in Tmem115
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01115:Tmem115 APN 9 107534582 missense probably damaging 1.00
IGL01142:Tmem115 APN 9 107534645 missense possibly damaging 0.94
IGL01386:Tmem115 APN 9 107534660 missense probably damaging 1.00
IGL01705:Tmem115 APN 9 107535204 missense probably benign 0.44
R0746:Tmem115 UTSW 9 107537999 missense probably benign 0.11
R1511:Tmem115 UTSW 9 107534975 missense probably benign 0.04
R4182:Tmem115 UTSW 9 107535283 missense probably damaging 1.00
R4770:Tmem115 UTSW 9 107534957 missense probably benign 0.43
R5097:Tmem115 UTSW 9 107534860 missense probably benign 0.03
R5141:Tmem115 UTSW 9 107537942 missense probably benign 0.01
R5687:Tmem115 UTSW 9 107534855 missense probably benign 0.17
X0067:Tmem115 UTSW 9 107534513 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCCCTCAAGCAAACTATGGG -3'
(R):5'- AAGTTCCCAGTACCTTCTGC -3'

Sequencing Primer
(F):5'- CCTCAAGCAAACTATGGGAGACTG -3'
(R):5'- CTCCGCATCTTGAGGGTCTG -3'
Posted On2019-05-15