Incidental Mutation 'R7145:Scn5a'
ID553725
Institutional Source Beutler Lab
Gene Symbol Scn5a
Ensembl Gene ENSMUSG00000032511
Gene Namesodium channel, voltage-gated, type V, alpha
SynonymsNav1.5c, Nav1.5, mH1, SkM2
Accession Numbers

Ncbi RefSeq: NM_021544.4, NM_001253860.1; MGI:98251

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7145 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location119483408-119579016 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 119486371 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 1757 (T1757I)
Ref Sequence ENSEMBL: ENSMUSP00000112838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065196] [ENSMUST00000117911] [ENSMUST00000120420]
Predicted Effect probably damaging
Transcript: ENSMUST00000065196
AA Change: T1757I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066228
Gene: ENSMUSG00000032511
AA Change: T1757I

DomainStartEndE-ValueType
Pfam:Ion_trans 130 423 2.4e-82 PFAM
Pfam:Na_trans_cytopl 478 667 5.2e-49 PFAM
Pfam:Ion_trans 716 950 1.1e-54 PFAM
Pfam:Na_trans_assoc 955 1203 2.9e-57 PFAM
Pfam:Ion_trans 1207 1484 2e-66 PFAM
Pfam:Ion_trans 1530 1786 7.2e-55 PFAM
Pfam:PKD_channel 1627 1780 3.5e-7 PFAM
IQ 1903 1925 5e-2 SMART
low complexity region 1961 1983 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117911
AA Change: T1757I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112838
Gene: ENSMUSG00000032511
AA Change: T1757I

DomainStartEndE-ValueType
Pfam:Ion_trans 159 412 9.6e-76 PFAM
coiled coil region 413 451 N/A INTRINSIC
Pfam:DUF3451 461 668 4.9e-44 PFAM
Pfam:Ion_trans 751 940 2.3e-46 PFAM
Pfam:Na_trans_assoc 955 1218 1.2e-73 PFAM
Pfam:Ion_trans 1244 1472 2e-56 PFAM
PDB:1BYY|A 1474 1526 5e-29 PDB
Pfam:Ion_trans 1565 1774 1.5e-49 PFAM
Pfam:PKD_channel 1627 1781 2.6e-10 PFAM
IQ 1903 1925 5e-2 SMART
low complexity region 1961 1983 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120420
AA Change: T1756I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113272
Gene: ENSMUSG00000032511
AA Change: T1756I

DomainStartEndE-ValueType
Pfam:Ion_trans 159 412 4.5e-75 PFAM
coiled coil region 413 451 N/A INTRINSIC
Pfam:DUF3451 461 668 7.4e-43 PFAM
Pfam:Ion_trans 751 940 1.2e-45 PFAM
Pfam:Na_trans_assoc 955 1217 1.6e-72 PFAM
Pfam:Ion_trans 1243 1471 1.1e-55 PFAM
PDB:1BYY|A 1473 1525 5e-29 PDB
Pfam:Ion_trans 1564 1773 8.2e-49 PFAM
Pfam:PKD_channel 1626 1780 2.6e-9 PFAM
IQ 1902 1924 5e-2 SMART
low complexity region 1960 1982 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype Strain: 2179753; 3765977
Lethality: E10-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an integral membrane protein and tetrodotoxin-resistant voltage-gated sodium channel subunit. This protein is found primarily in cardiac muscle and is responsible for the initial upstroke of the action potential in an electrocardiogram. Defects in this gene are a cause of long QT syndrome type 3 (LQT3), an autosomal dominant cardiac disease. Alternative splicing results in several transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for mutations in this gene die prenatally usually during organogenesis and may display decreased embryo size and abnormal cardiovascular system physiology. Heterozygous mice typically display abnormal heartbeats and defects in the function of the impulse conduction system. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted(9) Gene trapped(2)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,070,059 Y1670H probably damaging Het
Abca12 T C 1: 71,307,053 K886R possibly damaging Het
Adcy3 G A 12: 4,200,992 E584K probably benign Het
Ano3 A T 2: 110,862,860 V131D probably benign Het
Arhgdig C T 17: 26,199,363 W215* probably null Het
Cad G T 5: 31,067,612 W953L possibly damaging Het
Calhm2 T C 19: 47,135,641 Y88C probably benign Het
Cdk5rap2 A T 4: 70,238,231 D1681E probably benign Het
Cenpl T A 1: 161,082,912 L143H possibly damaging Het
Cherp T C 8: 72,468,386 K270E Het
Cmss1 A G 16: 57,311,355 I136T probably benign Het
Col23a1 T C 11: 51,565,223 probably null Het
Crnn C A 3: 93,148,382 D158E probably damaging Het
Dnmt3a A T 12: 3,872,844 Q149L probably benign Het
Dst T A 1: 34,189,882 N2185K probably benign Het
Elp2 T A 18: 24,604,069 N25K probably benign Het
Ephb4 A T 5: 137,372,046 D845V probably damaging Het
Esyt3 T C 9: 99,319,574 T561A probably damaging Het
F3 G T 3: 121,731,586 V159L probably damaging Het
Fam81a A T 9: 70,110,278 D128E probably damaging Het
Flot1 T G 17: 35,824,943 H155Q probably benign Het
Fut9 T A 4: 25,620,507 K102N probably damaging Het
Gm16368 G T 12: 88,083,827 C44F probably benign Het
Gm6309 T C 5: 146,170,290 Q82R possibly damaging Het
H13 A G 2: 152,681,072 N102D probably damaging Het
Lamc2 C G 1: 153,130,772 A878P possibly damaging Het
Lepr C T 4: 101,752,197 T327I probably benign Het
Lrp2 A G 2: 69,454,808 probably null Het
Ly86 A G 13: 37,377,010 K116E probably damaging Het
Mapk8ip2 T A 15: 89,458,998 F648I possibly damaging Het
Muc16 G A 9: 18,655,580 T1881I unknown Het
Myh13 T G 11: 67,354,740 S1069A probably benign Het
Myh4 T A 11: 67,260,228 I1903N possibly damaging Het
Myo18b A T 5: 112,817,679 L1341* probably null Het
Naa25 G T 5: 121,417,489 probably null Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Ncapg C T 5: 45,670,030 A3V possibly damaging Het
Ncln T C 10: 81,488,252 H481R probably benign Het
Nek4 C A 14: 30,982,348 Q607K probably damaging Het
Neo1 T C 9: 58,889,179 Y1182C probably damaging Het
Npnt T C 3: 132,909,931 N165S probably benign Het
Olfr1076 T C 2: 86,508,528 L23P probably damaging Het
Olfr1184 C T 2: 88,487,377 S215L probably damaging Het
Olfr145 A G 9: 37,897,563 H53R probably benign Het
Olfr167 C G 16: 19,514,899 V246L probably damaging Het
Otulin T C 15: 27,608,770 Y229C probably damaging Het
Palld A T 8: 61,532,017 D1071E unknown Het
Pcdhb20 T C 18: 37,505,089 S223P probably damaging Het
Pcdhga6 T A 18: 37,707,728 I167N probably damaging Het
Pcdhgb4 A G 18: 37,721,790 N413D probably benign Het
Pcdhgb8 T A 18: 37,762,997 Y373* probably null Het
Plxna2 G T 1: 194,649,522 V419L probably benign Het
Rpgrip1l A T 8: 91,232,806 probably null Het
Rsrc2 A G 5: 123,739,567 probably benign Het
Scaper C T 9: 55,912,111 D107N unknown Het
Scgb2b3 T A 7: 31,360,148 Y67F probably benign Het
Sgo2b G A 8: 63,928,184 P538L probably damaging Het
Slc9a3 A G 13: 74,150,678 K72R probably damaging Het
Smchd1 T A 17: 71,378,207 T1409S probably benign Het
Stab1 A T 14: 31,145,073 probably null Het
Sult2b1 T C 7: 45,733,632 E242G probably damaging Het
Tcaf1 A T 6: 42,686,753 H64Q probably damaging Het
Tle6 T C 10: 81,600,076 T2A possibly damaging Het
Tmem115 T C 9: 107,535,086 V203A probably benign Het
Tmem45b G A 9: 31,429,041 T108I probably damaging Het
Tmf1 A T 6: 97,176,118 D331E probably damaging Het
Txndc9 T C 1: 37,990,296 Y157C probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r27 C A 6: 124,191,752 R806S probably benign Het
Vmn2r59 G A 7: 42,045,764 A408V probably damaging Het
Ythdc1 T C 5: 86,816,608 V92A probably benign Het
Other mutations in Scn5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Scn5a APN 9 119486224 missense probably damaging 1.00
IGL00480:Scn5a APN 9 119517538 missense possibly damaging 0.73
IGL00542:Scn5a APN 9 119492126 missense probably damaging 1.00
IGL00852:Scn5a APN 9 119537682 missense probably benign 0.26
IGL00895:Scn5a APN 9 119513104 splice site probably null
IGL00905:Scn5a APN 9 119536501 missense probably damaging 1.00
IGL01347:Scn5a APN 9 119562441 nonsense probably null
IGL01396:Scn5a APN 9 119534704 missense probably damaging 0.98
IGL01402:Scn5a APN 9 119486470 missense probably damaging 1.00
IGL01404:Scn5a APN 9 119486470 missense probably damaging 1.00
IGL01487:Scn5a APN 9 119562623 start codon destroyed probably null 0.90
IGL01612:Scn5a APN 9 119486025 missense possibly damaging 0.86
IGL02134:Scn5a APN 9 119485892 missense probably damaging 0.98
IGL02434:Scn5a APN 9 119533793 missense possibly damaging 0.83
IGL02698:Scn5a APN 9 119521097 missense probably damaging 1.00
IGL02717:Scn5a APN 9 119529010 missense probably benign 0.12
IGL02746:Scn5a APN 9 119550637 missense probably damaging 1.00
IGL02951:Scn5a APN 9 119495685 missense probably damaging 1.00
IGL03155:Scn5a APN 9 119512182 missense possibly damaging 0.74
IGL03188:Scn5a APN 9 119522566 missense probably damaging 1.00
IGL03268:Scn5a APN 9 119521231 missense probably damaging 1.00
IGL03287:Scn5a APN 9 119489778 missense probably damaging 1.00
IGL03328:Scn5a APN 9 119537636 missense probably benign 0.12
PIT4142001:Scn5a UTSW 9 119486258 missense probably damaging 1.00
PIT4520001:Scn5a UTSW 9 119534570 missense possibly damaging 0.56
R0026:Scn5a UTSW 9 119522566 missense probably damaging 1.00
R0044:Scn5a UTSW 9 119492047 critical splice donor site probably null
R0044:Scn5a UTSW 9 119492047 critical splice donor site probably null
R0267:Scn5a UTSW 9 119543135 missense probably damaging 0.98
R0313:Scn5a UTSW 9 119534571 missense probably damaging 1.00
R0360:Scn5a UTSW 9 119522599 missense probably damaging 0.99
R0364:Scn5a UTSW 9 119522599 missense probably damaging 0.99
R0369:Scn5a UTSW 9 119533772 missense probably damaging 0.99
R0512:Scn5a UTSW 9 119550658 missense probably damaging 1.00
R0681:Scn5a UTSW 9 119539640 missense probably damaging 0.96
R1163:Scn5a UTSW 9 119533927 missense probably damaging 1.00
R1469:Scn5a UTSW 9 119533661 critical splice donor site probably null
R1469:Scn5a UTSW 9 119533661 critical splice donor site probably null
R1470:Scn5a UTSW 9 119536475 missense possibly damaging 0.82
R1470:Scn5a UTSW 9 119536475 missense possibly damaging 0.82
R1530:Scn5a UTSW 9 119495562 missense probably damaging 1.00
R1532:Scn5a UTSW 9 119533847 missense probably damaging 1.00
R1544:Scn5a UTSW 9 119486633 missense probably damaging 1.00
R1588:Scn5a UTSW 9 119521301 missense probably damaging 1.00
R1597:Scn5a UTSW 9 119562497 missense probably damaging 0.99
R1607:Scn5a UTSW 9 119486092 missense probably damaging 1.00
R1657:Scn5a UTSW 9 119562380 missense probably damaging 1.00
R1664:Scn5a UTSW 9 119521177 missense possibly damaging 0.84
R1785:Scn5a UTSW 9 119521129 missense probably damaging 1.00
R1925:Scn5a UTSW 9 119529019 missense probably benign
R1956:Scn5a UTSW 9 119517413 missense possibly damaging 0.82
R2006:Scn5a UTSW 9 119536480 missense probably damaging 1.00
R2061:Scn5a UTSW 9 119485651 missense probably damaging 0.98
R2083:Scn5a UTSW 9 119492123 missense probably benign 0.45
R2180:Scn5a UTSW 9 119516051 missense probably benign
R2216:Scn5a UTSW 9 119485612 missense probably benign 0.37
R2216:Scn5a UTSW 9 119513085 missense probably benign
R2320:Scn5a UTSW 9 119529956 critical splice donor site probably null
R2377:Scn5a UTSW 9 119539727 missense probably damaging 1.00
R2510:Scn5a UTSW 9 119533685 missense probably benign 0.05
R3113:Scn5a UTSW 9 119485672 missense probably damaging 1.00
R3769:Scn5a UTSW 9 119552076 critical splice acceptor site probably benign
R4133:Scn5a UTSW 9 119486372 missense probably damaging 1.00
R4164:Scn5a UTSW 9 119495778 missense probably damaging 1.00
R4447:Scn5a UTSW 9 119550627 missense probably damaging 1.00
R4635:Scn5a UTSW 9 119528985 missense possibly damaging 0.47
R4734:Scn5a UTSW 9 119539538 missense probably damaging 0.98
R4829:Scn5a UTSW 9 119534707 missense probably benign 0.00
R4867:Scn5a UTSW 9 119550671 nonsense probably null
R5055:Scn5a UTSW 9 119522566 missense probably damaging 1.00
R5229:Scn5a UTSW 9 119535976 missense probably damaging 1.00
R5344:Scn5a UTSW 9 119534007 missense probably benign 0.25
R5424:Scn5a UTSW 9 119501734 missense probably damaging 1.00
R5517:Scn5a UTSW 9 119495713 missense probably damaging 1.00
R5526:Scn5a UTSW 9 119521171 missense probably damaging 1.00
R5560:Scn5a UTSW 9 119560286 missense probably damaging 1.00
R5719:Scn5a UTSW 9 119530052 missense possibly damaging 0.91
R5726:Scn5a UTSW 9 119533847 missense probably damaging 1.00
R5800:Scn5a UTSW 9 119501666 missense probably damaging 1.00
R5826:Scn5a UTSW 9 119521333 missense probably damaging 1.00
R6046:Scn5a UTSW 9 119562374 missense probably damaging 1.00
R6101:Scn5a UTSW 9 119522650 missense probably damaging 0.98
R6162:Scn5a UTSW 9 119522555 missense probably damaging 0.98
R6375:Scn5a UTSW 9 119543356 missense probably damaging 1.00
R6378:Scn5a UTSW 9 119486036 missense probably damaging 1.00
R6464:Scn5a UTSW 9 119534580 missense probably damaging 1.00
R6794:Scn5a UTSW 9 119535889 missense probably damaging 0.98
R6799:Scn5a UTSW 9 119495622 missense possibly damaging 0.62
R6850:Scn5a UTSW 9 119501749 missense possibly damaging 0.92
R6858:Scn5a UTSW 9 119492090 missense probably benign 0.11
R6861:Scn5a UTSW 9 119530023 missense probably damaging 1.00
R6875:Scn5a UTSW 9 119486644 missense probably damaging 1.00
R6989:Scn5a UTSW 9 119486329 missense probably damaging 1.00
R7009:Scn5a UTSW 9 119485930 missense probably damaging 1.00
R7064:Scn5a UTSW 9 119489911 missense probably damaging 0.99
R7212:Scn5a UTSW 9 119543385 missense possibly damaging 0.94
R7238:Scn5a UTSW 9 119491544 missense possibly damaging 0.73
R7266:Scn5a UTSW 9 119562560 missense probably benign 0.37
X0023:Scn5a UTSW 9 119517769 missense probably damaging 1.00
X0065:Scn5a UTSW 9 119485669 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATACTCAATGAACTGGGTGGC -3'
(R):5'- ACTTTGCCTACGTCAAGTGG -3'

Sequencing Primer
(F):5'- AATGAACTGGGTGGCCTCCG -3'
(R):5'- TGGCATCGACGACATGTTC -3'
Posted On2019-05-15