Incidental Mutation 'R0601:Mpl'
ID55380
Institutional Source Beutler Lab
Gene Symbol Mpl
Ensembl Gene ENSMUSG00000006389
Gene Namemyeloproliferative leukemia virus oncogene
SynonymsTPO-R, thrombopoietin receptor, c-mpl, hlb219, CD110, c-mpl-I, c-mpl-II
MMRRC Submission 038790-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0601 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location118442415-118457513 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 118443536 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 599 (T599S)
Ref Sequence ENSEMBL: ENSMUSP00000006556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006556] [ENSMUST00000102671] [ENSMUST00000106375]
Predicted Effect probably benign
Transcript: ENSMUST00000006556
AA Change: T599S

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000006556
Gene: ENSMUSG00000006389
AA Change: T599S

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 18 121 1.9e-31 PFAM
Pfam:IL6Ra-bind 27 118 1.8e-7 PFAM
FN3 126 257 7.7e-3 SMART
FN3 382 461 2.83e0 SMART
transmembrane domain 483 505 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102671
AA Change: T591S

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000099732
Gene: ENSMUSG00000006389
AA Change: T591S

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 25 128 1.4e-32 PFAM
Pfam:IL6Ra-bind 34 125 7.3e-9 PFAM
FN3 133 256 1.09e-2 SMART
FN3 381 460 2.83e0 SMART
transmembrane domain 482 504 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106375
AA Change: T532S

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000101983
Gene: ENSMUSG00000006389
AA Change: T532S

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 18 121 9.4e-32 PFAM
Pfam:IL6Ra-bind 27 119 7.4e-8 PFAM
FN3 322 401 2.83e0 SMART
transmembrane domain 423 445 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121913
Predicted Effect probably benign
Transcript: ENSMUST00000168404
SMART Domains Protein: ENSMUSP00000130167
Gene: ENSMUSG00000006389

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 25 128 1.9e-31 PFAM
FN3 133 264 7.7e-3 SMART
FN3 389 468 2.83e0 SMART
transmembrane domain 490 512 N/A INTRINSIC
Meta Mutation Damage Score 0.08 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.2%
Validation Efficiency 98% (119/122)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In 1990 an oncogene, v-mpl, was identified from the murine myeloproliferative leukemia virus that was capable of immortalizing bone marrow hematopoietic cells from different lineages. In 1992 the human homologue, named, c-mpl, was cloned. Sequence data revealed that c-mpl encoded a protein that was homologous with members of the hematopoietic receptor superfamily. Presence of anti-sense oligodeoxynucleotides of c-mpl inhibited megakaryocyte colony formation. The ligand for c-mpl, thrombopoietin, was cloned in 1994. Thrombopoietin was shown to be the major regulator of megakaryocytopoiesis and platelet formation. The protein encoded by the c-mpl gene, CD110, is a 635 amino acid transmembrane domain, with two extracellular cytokine receptor domains and two intracellular cytokine receptor box motifs . TPO-R deficient mice were severely thrombocytopenic, emphasizing the important role of CD110 and thrombopoietin in megakaryocyte and platelet formation. Upon binding of thrombopoietin CD110 is dimerized and the JAK family of non-receptor tyrosine kinases, as well as the STAT family, the MAPK family, the adaptor protein Shc and the receptors themselves become tyrosine phosphorylated. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations at this locus are unable to produce normal amounts of megakaryocytes and platelets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 119 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930596D02Rik T G 14: 35,810,189 D143A probably damaging Het
Abca9 C T 11: 110,117,058 probably null Het
Abcc5 A G 16: 20,404,559 probably benign Het
Ablim3 T A 18: 61,849,370 D168V probably benign Het
Acsl3 C T 1: 78,696,179 S352F probably damaging Het
Adgrl4 A T 3: 151,498,429 probably benign Het
Arhgap29 A G 3: 121,991,110 K229E probably damaging Het
Atad3a A T 4: 155,747,407 V470D probably damaging Het
Atp8b1 A G 18: 64,571,653 probably null Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Bpifa5 A G 2: 154,164,255 N121S possibly damaging Het
Bpifb4 G A 2: 153,947,283 probably benign Het
Bptf T A 11: 107,061,692 T2112S probably benign Het
Btnl4 T C 17: 34,469,311 K498E probably benign Het
Calhm2 A G 19: 47,141,030 probably null Het
Capn3 A T 2: 120,502,596 probably null Het
Caps2 T C 10: 112,195,790 F265L possibly damaging Het
Casp3 G T 8: 46,636,227 C170F probably benign Het
Ccdc39 T C 3: 33,819,839 R615G probably damaging Het
Cd177 A G 7: 24,752,313 I426T probably benign Het
Cfap53 G A 18: 74,300,150 R102H possibly damaging Het
Cfhr3 G A 1: 139,593,885 noncoding transcript Het
Col7a1 T C 9: 108,980,584 probably benign Het
Cplx3 T C 9: 57,606,074 E24G possibly damaging Het
D11Wsu47e T A 11: 113,687,886 S36T probably benign Het
Dhx30 A G 9: 110,086,714 probably null Het
Dnah8 T A 17: 30,708,358 N1329K probably benign Het
Dnajc11 C G 4: 151,969,936 R200G probably damaging Het
Dok3 A T 13: 55,524,263 F201I probably benign Het
Dpf2 A T 19: 5,902,212 H303Q probably damaging Het
Dtnb A G 12: 3,735,039 probably benign Het
Elk3 T C 10: 93,265,481 E136G probably damaging Het
Ephb1 T C 9: 102,195,130 D150G probably damaging Het
Erbb3 A G 10: 128,577,012 S570P probably benign Het
F2 A T 2: 91,633,311 probably null Het
Fanca A T 8: 123,308,513 M231K probably damaging Het
Fbxo34 T C 14: 47,530,257 V358A probably benign Het
Foxp1 C T 6: 98,930,122 E666K probably damaging Het
Fto A G 8: 91,401,802 probably null Het
Gbp2 C T 3: 142,630,758 R290C possibly damaging Het
Grik2 T G 10: 49,422,597 S343R probably damaging Het
Heatr5b A T 17: 78,768,545 M1448K probably benign Het
Hmgn3 A T 9: 83,146,429 probably null Het
Htt T C 5: 34,846,003 V1274A probably benign Het
Kcnh8 A G 17: 52,894,005 D489G probably damaging Het
Kcnip3 A T 2: 127,458,397 probably benign Het
Kdm5a A G 6: 120,402,671 T647A possibly damaging Het
Krt72 T C 15: 101,786,056 R135G probably damaging Het
Larp7 T A 3: 127,544,209 K400N probably damaging Het
Lifr T C 15: 7,169,272 probably null Het
Lima1 G A 15: 99,780,472 P696L probably damaging Het
Lrrc8e T G 8: 4,235,239 probably null Het
Map1a A G 2: 121,298,602 R116G probably damaging Het
Map3k13 A G 16: 21,905,249 E327G possibly damaging Het
Med13 A G 11: 86,345,962 V123A possibly damaging Het
Megf8 A C 7: 25,328,540 H205P probably benign Het
Met G A 6: 17,555,632 probably null Het
Mfsd14b A C 13: 65,087,150 V71G possibly damaging Het
Myh15 A T 16: 49,061,581 D62V probably damaging Het
Myo5a A G 9: 75,174,015 T961A probably benign Het
Myrfl A G 10: 116,776,760 Y895H probably damaging Het
Nap1l1 T C 10: 111,490,363 probably benign Het
Ncapd3 T A 9: 27,041,507 Y111N probably benign Het
Nlrc3 A G 16: 3,948,249 probably benign Het
Nsun2 G T 13: 69,633,242 V657L probably benign Het
Olfr1026 A T 2: 85,923,378 I37F probably benign Het
Olfr1247 T A 2: 89,609,220 N294I probably benign Het
Olfr142 T C 2: 90,252,934 D18G probably benign Het
Olfr1511 C A 14: 52,389,826 G316* probably null Het
Olfr195 G A 16: 59,149,754 M301I probably benign Het
Olfr596 T C 7: 103,310,164 S148P probably damaging Het
Olfr646 A T 7: 104,107,142 I288F possibly damaging Het
Olfr780 T A 10: 129,322,016 M131K possibly damaging Het
Osbpl3 A T 6: 50,299,403 V795D probably benign Het
Osbpl5 T C 7: 143,709,549 D155G probably damaging Het
Parm1 G A 5: 91,594,264 V164I probably benign Het
Pgd A T 4: 149,156,810 probably benign Het
Pkp1 G A 1: 135,878,182 R593W probably damaging Het
Polr2l A T 7: 141,473,342 V53E probably damaging Het
Ppp4c G T 7: 126,787,288 T29K probably benign Het
Ppp4r4 T A 12: 103,600,520 probably benign Het
Ptprd A G 4: 76,100,474 S688P probably benign Het
Rab3b A T 4: 108,890,389 I28F probably damaging Het
Rnase4 T C 14: 51,105,095 L92P probably benign Het
Rnpc3 T C 3: 113,620,106 E229G probably benign Het
Rtraf A T 14: 19,816,206 D147E possibly damaging Het
Rttn G A 18: 89,042,966 G1086D probably benign Het
Ryr2 A G 13: 11,705,633 probably null Het
Sft2d2 T C 1: 165,183,861 I126V probably benign Het
Skap1 G T 11: 96,723,410 probably benign Het
Slc14a2 A T 18: 78,157,179 L753* probably null Het
Slc25a5 G A X: 36,795,755 A9T probably benign Het
Slc30a5 T C 13: 100,814,770 probably benign Het
Slc5a4b A C 10: 76,064,036 I456S possibly damaging Het
Slc9a4 A T 1: 40,603,070 S400C probably damaging Het
Slx1b T A 7: 126,692,640 H84L probably damaging Het
Sptbn1 T C 11: 30,150,008 Y190C probably damaging Het
Stk32b T C 5: 37,531,566 Q138R probably damaging Het
Syt6 C A 3: 103,620,890 D308E probably damaging Het
Sytl2 G A 7: 90,395,166 D572N probably damaging Het
Taok2 A T 7: 126,879,433 L109Q probably damaging Het
Tbl1xr1 T C 3: 22,179,319 probably benign Het
Tlk1 A G 2: 70,714,158 I711T probably benign Het
Trf A G 9: 103,222,933 probably null Het
Trpc2 A G 7: 102,084,365 T548A possibly damaging Het
Ttbk2 A T 2: 120,825,296 I29N possibly damaging Het
Tti1 A T 2: 157,993,372 C989S probably damaging Het
Txndc8 A G 4: 58,000,256 Y108H probably benign Het
Ugt2b1 A T 5: 86,917,680 V500D possibly damaging Het
Vmn1r34 A G 6: 66,637,664 I30T possibly damaging Het
Vmn2r115 A G 17: 23,360,100 K849R probably null Het
Vmn2r76 T A 7: 86,226,115 probably null Het
Vps13c T A 9: 67,927,472 S1694R probably benign Het
Wdfy3 G T 5: 101,836,172 P3509T probably benign Het
Wdr59 GGGTGGTG GGGTG 8: 111,480,540 probably benign Het
Wdr60 T C 12: 116,255,935 D129G possibly damaging Het
Wnt8b T A 19: 44,493,667 W40R probably benign Het
Xrra1 A G 7: 99,910,968 I384V possibly damaging Het
Zfp11 A T 5: 129,657,907 H163Q probably damaging Het
Other mutations in Mpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Mpl APN 4 118455661 missense possibly damaging 0.94
IGL02096:Mpl APN 4 118457136 missense possibly damaging 0.46
IGL02681:Mpl APN 4 118448871 splice site probably benign
R0238:Mpl UTSW 4 118456863 splice site probably benign
R0309:Mpl UTSW 4 118446038 intron probably benign
R0539:Mpl UTSW 4 118443508 missense possibly damaging 0.68
R0558:Mpl UTSW 4 118444020 missense probably damaging 0.99
R0784:Mpl UTSW 4 118446406 missense possibly damaging 0.59
R1016:Mpl UTSW 4 118448913 missense probably damaging 1.00
R1532:Mpl UTSW 4 118448568 missense possibly damaging 0.63
R1590:Mpl UTSW 4 118444024 missense probably damaging 0.99
R1806:Mpl UTSW 4 118443532 missense possibly damaging 0.73
R1875:Mpl UTSW 4 118456829 missense probably benign
R1935:Mpl UTSW 4 118455739 missense probably benign 0.01
R2182:Mpl UTSW 4 118457413 missense probably benign
R2291:Mpl UTSW 4 118449000 missense probably benign 0.04
R2508:Mpl UTSW 4 118455757 missense probably damaging 1.00
R4242:Mpl UTSW 4 118456771 missense probably damaging 0.98
R4718:Mpl UTSW 4 118456724 missense probably benign 0.02
R4775:Mpl UTSW 4 118448580 missense probably damaging 1.00
R5158:Mpl UTSW 4 118456684 missense probably damaging 0.98
R5208:Mpl UTSW 4 118455881 missense probably benign 0.00
R5276:Mpl UTSW 4 118455721 missense probably benign
R5953:Mpl UTSW 4 118454510 missense possibly damaging 0.89
R5953:Mpl UTSW 4 118454511 missense probably damaging 0.99
R6439:Mpl UTSW 4 118448553 missense probably damaging 0.98
R6450:Mpl UTSW 4 118448700 splice site probably null
R6521:Mpl UTSW 4 118455117 critical splice donor site probably null
R6812:Mpl UTSW 4 118455264 missense probably benign 0.03
R6876:Mpl UTSW 4 118457120 missense probably damaging 1.00
R7095:Mpl UTSW 4 118444063 missense
R7100:Mpl UTSW 4 118457410 missense
R7173:Mpl UTSW 4 118448544 critical splice donor site probably null
R7177:Mpl UTSW 4 118448544 critical splice donor site probably null
R7512:Mpl UTSW 4 118448892 missense
Predicted Primers PCR Primer
(F):5'- ACAGGGCATGGCAACTTTAGTCAC -3'
(R):5'- TCTCTCAGTCTAAGGCCACGGTTAC -3'

Sequencing Primer
(F):5'- catagcaagttataggtcatcagag -3'
(R):5'- CTAAGGCCACGGTTACCGATAG -3'
Posted On2013-07-11