Incidental Mutation 'R7146:Spire2'
ID553800
Institutional Source Beutler Lab
Gene Symbol Spire2
Ensembl Gene ENSMUSG00000010154
Gene Namespire type actin nucleation factor 2
SynonymsSpir-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R7146 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location123332713-123369515 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 123369250 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 671 (D671E)
Ref Sequence ENSEMBL: ENSMUSP00000010298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010298] [ENSMUST00000057934] [ENSMUST00000108840] [ENSMUST00000127664] [ENSMUST00000211932] [ENSMUST00000212404] [ENSMUST00000212470] [ENSMUST00000212569] [ENSMUST00000212571]
Predicted Effect probably benign
Transcript: ENSMUST00000010298
AA Change: D671E

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000010298
Gene: ENSMUSG00000010154
AA Change: D671E

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
KIND 26 207 2.63e-82 SMART
PDB:4EFH|B 310 360 8e-8 PDB
low complexity region 419 431 N/A INTRINSIC
low complexity region 496 513 N/A INTRINSIC
SCOP:d1zbdb_ 540 636 7e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000057934
SMART Domains Protein: ENSMUSP00000056485
Gene: ENSMUSG00000001472

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
low complexity region 34 55 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
Pfam:Tcf25 248 588 4.6e-120 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108840
SMART Domains Protein: ENSMUSP00000104468
Gene: ENSMUSG00000001472

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
low complexity region 34 55 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
Pfam:Tcf25 247 588 2.3e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000211932
Predicted Effect probably benign
Transcript: ENSMUST00000212404
AA Change: D571E

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000212470
Predicted Effect probably benign
Transcript: ENSMUST00000212569
Predicted Effect probably benign
Transcript: ENSMUST00000212571
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,255,297 I895F probably benign Het
Abca16 A G 7: 120,527,751 N1222D possibly damaging Het
Abcc4 A T 14: 118,615,181 Y499N probably damaging Het
Adgrg7 A C 16: 56,730,242 C702W probably damaging Het
Adk C A 14: 21,326,614 P27H Het
Ankrd13a T C 5: 114,775,232 S2P probably damaging Het
Ano1 T C 7: 144,655,656 H269R probably benign Het
Asl G A 5: 130,024,449 probably benign Het
Asxl2 A T 12: 3,457,066 D86V probably damaging Het
Bach2 A G 4: 32,562,670 D379G probably damaging Het
Bdkrb1 T A 12: 105,604,883 L236Q probably damaging Het
Cacna2d3 T C 14: 29,721,697 Y24C unknown Het
Cage1 G T 13: 38,023,049 N273K probably benign Het
Ccdc51 T A 9: 109,091,780 I245N probably damaging Het
Cep152 T C 2: 125,614,405 I229V probably benign Het
Chst4 T A 8: 110,030,731 S167C probably damaging Het
Cntnap4 A T 8: 112,810,636 Y713F probably damaging Het
Cog8 G T 8: 107,052,373 T424K possibly damaging Het
Cyp2j6 A G 4: 96,545,782 I97T probably damaging Het
D430041D05Rik T C 2: 104,258,353 T131A probably benign Het
Dnah17 T C 11: 118,082,110 D1999G probably damaging Het
Dnah8 A G 17: 30,644,617 D250G probably benign Het
Dnah8 T C 17: 30,769,644 V3196A possibly damaging Het
Dscam A T 16: 96,829,917 Y299* probably null Het
Ephb1 A G 9: 101,963,958 S774P probably damaging Het
Fat1 G A 8: 44,950,925 V238I probably benign Het
Fermt1 C T 2: 132,934,865 M234I probably benign Het
Fmnl2 C T 2: 53,068,540 S212L Het
Frem1 T C 4: 82,922,295 N1798S possibly damaging Het
Gabrd T A 4: 155,385,406 M449L probably benign Het
Gad1 T C 2: 70,587,362 F302L probably benign Het
Gm10800 A AC 2: 98,667,033 probably null Het
Gm11639 A G 11: 104,967,752 N3879S unknown Het
Gm11639 A C 11: 105,022,938 D4594A probably benign Het
Gm21886 GGGCCTGCAGACAGTAGGTGCTCACTAGGGCCTGTAAATAGTAGGTGCTCACTGAGGCCTGTAGACAGTAGGTGCTCA GGGCCTGTAGACAGTAGGTGCTCA 18: 80,089,482 probably benign Het
Gnb3 C T 6: 124,836,924 probably null Het
Gtf3c1 A T 7: 125,672,821 M642K possibly damaging Het
Hps3 A T 3: 20,008,886 W838R probably damaging Het
Ide A T 19: 37,295,944 W527R Het
Ighe A T 12: 113,272,355 I117N Het
Ighv1-50 T C 12: 115,119,776 E108G probably benign Het
Ivl G A 3: 92,572,231 P176S probably damaging Het
Lamb2 T A 9: 108,484,084 L605Q possibly damaging Het
Lgi3 G A 14: 70,533,392 R157H probably damaging Het
Lrp1b G T 2: 41,375,994 C1053* probably null Het
Mcpt9 A T 14: 56,026,988 S217T probably damaging Het
Mgat4c T G 10: 102,388,496 N190K probably damaging Het
Mknk1 T A 4: 115,864,592 V111D probably damaging Het
Mmp11 T C 10: 75,928,446 T62A probably benign Het
Mmp1b C A 9: 7,385,014 V212F probably damaging Het
Mmp7 A G 9: 7,697,586 probably null Het
Muc5b C T 7: 141,863,967 T3550M possibly damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nphp3 A T 9: 104,004,837 K169* probably null Het
Npy6r G T 18: 44,275,721 V70F probably benign Het
Nsun2 T A 13: 69,626,553 probably null Het
Oplah T A 15: 76,302,660 I652F probably benign Het
Pcdh18 T C 3: 49,755,822 N348S probably damaging Het
Pcdhb5 T A 18: 37,321,356 V263D probably damaging Het
Pcdhga1 C A 18: 37,662,111 T56N probably benign Het
Pdk4 A G 6: 5,491,068 probably null Het
Pfkp C A 13: 6,602,781 V434F probably benign Het
Phospho1 G A 11: 95,830,906 R134H probably damaging Het
Polg2 G T 11: 106,772,746 Q374K probably benign Het
Psmd6 GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC 14: 14,119,882 probably null Het
Ptpra T C 2: 130,537,651 probably null Het
Rassf3 C T 10: 121,416,147 E120K probably benign Het
Reln A T 5: 22,106,097 S273T probably damaging Het
Scarb1 C T 5: 125,284,025 A133T probably benign Het
Scn3a T A 2: 65,483,142 K1142N probably damaging Het
Sema3c G A 5: 17,694,703 V398I probably benign Het
Serpine1 C A 5: 137,071,064 Q80H probably damaging Het
Sh3gl1 G A 17: 56,017,646 T334M probably damaging Het
Smg7 T C 1: 152,861,825 N122D probably benign Het
Speer4b T C 5: 27,498,710 I144V probably benign Het
Sspo A T 6: 48,501,095 H5144L probably benign Het
Sstr2 A T 11: 113,625,353 Q366L probably damaging Het
Ssu72 T C 4: 155,731,393 F98S probably damaging Het
Syde2 C T 3: 146,007,115 Q1003* probably null Het
Tapbp G A 17: 33,925,487 A186T possibly damaging Het
Tatdn2 GGAAGGTGGAAGGACCAAGCAAGAAGGTGGAAGGACCA GGAAGGTGGAAGGACCA 6: 113,702,363 probably benign Het
Tnfrsf22 A T 7: 143,640,819 C124S probably damaging Het
Txlnb A T 10: 17,827,798 T235S possibly damaging Het
Uaca T C 9: 60,870,413 L694P probably damaging Het
Unc13a T A 8: 71,630,553 N1620Y probably damaging Het
Vmn2r10 C T 5: 109,003,334 C138Y probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r28 T A 7: 5,481,496 E568D probably benign Het
Vmn2r57 A T 7: 41,448,471 H57Q possibly damaging Het
Vwa5b1 A G 4: 138,581,612 S756P probably benign Het
Washc5 C A 15: 59,352,501 E470* probably null Het
Xpot A T 10: 121,606,773 V508D probably damaging Het
Zfp616 A T 11: 74,085,261 K785N possibly damaging Het
Zfp653 T C 9: 22,065,899 N119D probably damaging Het
Zfp729b A G 13: 67,593,376 S257P probably damaging Het
Zfp82 T A 7: 30,056,167 T497S probably benign Het
Znrf4 T G 17: 56,512,305 M1L probably benign Het
Other mutations in Spire2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Spire2 APN 8 123354059 missense probably damaging 1.00
IGL01610:Spire2 APN 8 123356763 missense probably damaging 1.00
IGL01611:Spire2 APN 8 123359398 missense probably damaging 1.00
IGL01776:Spire2 APN 8 123359392 missense probably damaging 0.98
IGL02164:Spire2 APN 8 123332964 missense probably damaging 0.99
IGL03005:Spire2 APN 8 123363368 missense probably benign 0.16
R0127:Spire2 UTSW 8 123358097 splice site probably benign
R0194:Spire2 UTSW 8 123363011 splice site probably benign
R0571:Spire2 UTSW 8 123354116 missense probably damaging 1.00
R1386:Spire2 UTSW 8 123361366 critical splice donor site probably null
R1526:Spire2 UTSW 8 123368763 missense probably benign 0.08
R1538:Spire2 UTSW 8 123358156 missense probably damaging 1.00
R1917:Spire2 UTSW 8 123363071 missense probably benign 0.00
R1919:Spire2 UTSW 8 123363071 missense probably benign 0.00
R2018:Spire2 UTSW 8 123332918 missense probably damaging 1.00
R2019:Spire2 UTSW 8 123332918 missense probably damaging 1.00
R4524:Spire2 UTSW 8 123360235 missense probably benign
R4672:Spire2 UTSW 8 123358111 missense probably benign 0.06
R4931:Spire2 UTSW 8 123368784 missense possibly damaging 0.54
R4973:Spire2 UTSW 8 123356844 missense probably damaging 1.00
R5057:Spire2 UTSW 8 123358201 missense probably damaging 1.00
R5702:Spire2 UTSW 8 123346663 missense probably benign 0.07
R5899:Spire2 UTSW 8 123354094 missense probably damaging 1.00
R6747:Spire2 UTSW 8 123356846 missense probably damaging 1.00
R6816:Spire2 UTSW 8 123359413 missense probably benign 0.12
R6823:Spire2 UTSW 8 123356727 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCCTTTGTAGGGATGAAC -3'
(R):5'- TGATGGCAGCTGTGTTCCAG -3'

Sequencing Primer
(F):5'- CCTTTGTAGGGATGAACATTGATTGC -3'
(R):5'- CAGCTGTGTTCCAGGATGG -3'
Posted On2019-05-15