Incidental Mutation 'R7147:Vps11'
ID553885
Institutional Source Beutler Lab
Gene Symbol Vps11
Ensembl Gene ENSMUSG00000032127
Gene NameVPS11, CORVET/HOPS core subunit
Synonyms1200011A11Rik
Accession Numbers

Ncbi RefSeq: NM_027889.1; MGI:1918982

Is this an essential gene? Possibly non essential (E-score: 0.426) question?
Stock #R7147 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location44347749-44361670 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 44355082 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 436 (L436*)
Ref Sequence ENSEMBL: ENSMUSP00000034644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034644] [ENSMUST00000213249] [ENSMUST00000213740] [ENSMUST00000214510]
Predicted Effect probably null
Transcript: ENSMUST00000034644
AA Change: L436*
SMART Domains Protein: ENSMUSP00000034644
Gene: ENSMUSG00000032127
AA Change: L436*

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
SCOP:d1erja_ 59 292 3e-10 SMART
Blast:WD40 73 117 2e-22 BLAST
Blast:WD40 125 168 9e-24 BLAST
Blast:WD40 175 214 6e-16 BLAST
Blast:WD40 219 259 2e-20 BLAST
Pfam:Clathrin 412 548 2.7e-16 PFAM
coiled coil region 775 813 N/A INTRINSIC
RING 822 860 6.14e-5 SMART
Pfam:VPS11_C 862 908 5.2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213249
Predicted Effect probably benign
Transcript: ENSMUST00000213740
Predicted Effect probably benign
Transcript: ENSMUST00000214460
Predicted Effect probably benign
Transcript: ENSMUST00000214510
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human homolog of yeast class C Vps11 protein. The mammalian class C Vps proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
Allele List at MGI

All alleles(8) : Targeted(4) Gene trapped(4)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 C T 14: 55,779,725 G303D probably damaging Het
Adgra3 C T 5: 49,961,245 G987D probably damaging Het
Akap11 A G 14: 78,511,465 S1161P Het
Ampd3 G A 7: 110,804,852 E528K probably damaging Het
Arl8b G A 6: 108,815,015 R79Q probably damaging Het
Atf4 AAGCGGGCTGAGC AAGC 15: 80,257,299 probably benign Het
Cald1 A T 6: 34,746,296 Q105L Het
Casd1 T C 6: 4,624,187 Y327H probably benign Het
Chodl T A 16: 78,946,741 C239S probably damaging Het
D130043K22Rik A T 13: 24,882,563 H781L probably benign Het
Dlg1 A T 16: 31,791,854 M318L probably benign Het
Dlgap1 T C 17: 70,662,758 S520P probably benign Het
Dmxl2 T C 9: 54,416,729 I950V probably benign Het
Dnah17 T A 11: 118,094,929 T1441S probably benign Het
Dock7 A T 4: 98,961,417 N1638K unknown Het
Ect2 A T 3: 27,150,090 D23E probably benign Het
Ephx1 T A 1: 181,001,819 T55S probably damaging Het
F11 T C 8: 45,250,146 Y169C probably damaging Het
Fbxw27 A G 9: 109,789,323 probably null Het
Fhl5 T A 4: 25,213,777 probably null Het
Gm5145 G A 17: 20,571,061 E234K probably damaging Het
Gm5737 A T 7: 120,813,015 R33S probably damaging Het
Gpr39 G A 1: 125,872,501 D330N possibly damaging Het
Greb1 C T 12: 16,733,427 R102H probably damaging Het
Hist1h4m A G 13: 21,811,989 D69G probably damaging Het
Ighmbp2 T C 19: 3,271,676 K361R probably benign Het
Inpp4b A G 8: 81,902,771 D245G probably damaging Het
Ints14 T C 9: 64,983,985 V416A possibly damaging Het
Kif21a A G 15: 90,980,883 S529P probably benign Het
Limk1 A G 5: 134,657,341 M609T probably benign Het
Lrrc75a G A 11: 62,605,969 P256S probably damaging Het
Mcc T C 18: 44,493,513 R339G probably damaging Het
Mdga1 C T 17: 29,846,521 W371* probably null Het
Mei4 T A 9: 81,927,596 L244Q probably damaging Het
Mical2 C T 7: 112,323,603 P605L possibly damaging Het
Mrgprf G T 7: 145,308,391 R230L possibly damaging Het
Nlgn1 T A 3: 26,133,360 R125S probably benign Het
Olfr652 A G 7: 104,564,066 probably benign Het
Papola A T 12: 105,808,638 probably benign Het
Pold2 T C 11: 5,873,095 D360G probably benign Het
Prr12 T C 7: 45,033,850 R1797G unknown Het
Psmg2 C T 18: 67,653,268 P233S probably benign Het
Ptprh A G 7: 4,550,782 W857R probably damaging Het
Raet1e A T 10: 22,181,280 M168L probably benign Het
Rhbdl2 A T 4: 123,810,115 Y61F probably damaging Het
Sacm1l A G 9: 123,568,951 N236S probably damaging Het
Sbf2 A T 7: 110,447,061 S310T probably benign Het
Sh3d19 T A 3: 86,104,277 I390N possibly damaging Het
Slco3a1 A G 7: 74,504,294 Y177H probably damaging Het
Smo G A 6: 29,758,449 G531D possibly damaging Het
Snx25 A C 8: 46,105,196 V258G probably damaging Het
Spata31d1b T A 13: 59,718,214 S1059T probably benign Het
Srgap2 C T 1: 131,310,594 C274Y Het
Srrm1 A G 4: 135,346,826 I48T probably damaging Het
Syne1 A T 10: 5,249,340 V3719E probably damaging Het
Tcerg1 T A 18: 42,550,063 M616K probably benign Het
Tgtp2 G C 11: 49,059,308 R146G probably damaging Het
Tie1 A T 4: 118,484,413 V234D probably damaging Het
Tom1 A G 8: 75,057,267 N293S probably damaging Het
Trim13 A T 14: 61,604,631 K32N probably damaging Het
Trim6 G A 7: 104,225,570 V5I probably benign Het
Vps50 C T 6: 3,567,750 Q549* probably null Het
Vtcn1 T A 3: 100,883,894 F83I probably damaging Het
Zfp131 T C 13: 119,766,543 T523A probably benign Het
Zfp758 A T 17: 22,376,000 Y489F possibly damaging Het
Zfp804a T C 2: 82,258,187 Y787H probably benign Het
Zfp9 C T 6: 118,465,002 C233Y probably damaging Het
Other mutations in Vps11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01977:Vps11 APN 9 44356219 splice site probably benign
IGL03135:Vps11 APN 9 44356356 missense probably benign 0.39
PIT4696001:Vps11 UTSW 9 44358189 missense possibly damaging 0.89
R0042:Vps11 UTSW 9 44356291 nonsense probably null
R0042:Vps11 UTSW 9 44356291 nonsense probably null
R0122:Vps11 UTSW 9 44354512 missense probably damaging 1.00
R0335:Vps11 UTSW 9 44353838 missense probably null 0.02
R0714:Vps11 UTSW 9 44359656 missense possibly damaging 0.90
R1068:Vps11 UTSW 9 44353019 missense probably damaging 1.00
R1873:Vps11 UTSW 9 44359936 missense probably damaging 1.00
R1991:Vps11 UTSW 9 44359227 missense probably damaging 0.97
R2068:Vps11 UTSW 9 44358316 missense probably damaging 0.99
R2084:Vps11 UTSW 9 44353261 missense probably benign 0.14
R2103:Vps11 UTSW 9 44359227 missense probably damaging 0.97
R2119:Vps11 UTSW 9 44348997 missense probably benign 0.01
R4160:Vps11 UTSW 9 44355720 missense probably damaging 0.98
R4161:Vps11 UTSW 9 44355720 missense probably damaging 0.98
R4564:Vps11 UTSW 9 44361597 missense probably damaging 1.00
R4879:Vps11 UTSW 9 44353300 missense probably benign
R5629:Vps11 UTSW 9 44356376 missense probably damaging 1.00
R5910:Vps11 UTSW 9 44359135 splice site probably null
R5988:Vps11 UTSW 9 44353924 missense probably benign 0.01
R6430:Vps11 UTSW 9 44361550 missense probably benign 0.11
R7002:Vps11 UTSW 9 44355079 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTACGTCATGCTGAAGAAC -3'
(R):5'- ACTGAAACCGCATTGACTTTG -3'

Sequencing Primer
(F):5'- CTGAAGAACAGCAAGTCTGAGC -3'
(R):5'- AACCGCATTGACTTTGTTAGAAGTGG -3'
Posted On2019-05-15