Incidental Mutation 'R7148:Fzd9'
ID553935
Institutional Source Beutler Lab
Gene Symbol Fzd9
Ensembl Gene ENSMUSG00000049551
Gene Namefrizzled class receptor 9
Synonymsmfz9, frizzled 9
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.282) question?
Stock #R7148 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location135248938-135251230 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135249690 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 447 (V447A)
Ref Sequence ENSEMBL: ENSMUSP00000053551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002825] [ENSMUST00000062572]
Predicted Effect probably benign
Transcript: ENSMUST00000002825
SMART Domains Protein: ENSMUSP00000002825
Gene: ENSMUSG00000002748

DomainStartEndE-ValueType
Pfam:WAC_Acf1_DNA_bd 21 120 2.6e-28 PFAM
low complexity region 312 335 N/A INTRINSIC
low complexity region 386 397 N/A INTRINSIC
low complexity region 453 468 N/A INTRINSIC
low complexity region 482 493 N/A INTRINSIC
coiled coil region 537 587 N/A INTRINSIC
DDT 605 669 5.59e-17 SMART
Pfam:WHIM1 725 773 2.2e-9 PFAM
low complexity region 822 835 N/A INTRINSIC
coiled coil region 854 890 N/A INTRINSIC
Pfam:WHIM2 900 935 1.3e-10 PFAM
Pfam:WHIM3 991 1029 1.5e-16 PFAM
low complexity region 1131 1148 N/A INTRINSIC
PHD 1186 1232 1.89e-14 SMART
RING 1187 1231 7.85e-2 SMART
low complexity region 1245 1277 N/A INTRINSIC
BROMO 1333 1441 3.63e-37 SMART
low complexity region 1459 1472 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000062572
AA Change: V447A

PolyPhen 2 Score 0.399 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000053551
Gene: ENSMUSG00000049551
AA Change: V447A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FRI 39 158 1.97e-73 SMART
low complexity region 177 195 N/A INTRINSIC
Frizzled 222 548 4.64e-199 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the 'frizzled' gene family encode 7-transmembrane domain proteins that are receptors for Wnt signaling proteins. The FZD9 gene is located within the Williams syndrome common deletion region of chromosome 7, and heterozygous deletion of the FZD9 gene may contribute to the Williams syndrome phenotype. FZD9 is expressed predominantly in brain, testis, eye, skeletal muscle, and kidney. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one allele exhibit immune system abnormalities while another null allele causes neurological abnormalities. A third null mutation results in growth retardation and abnormalities in bone mineralization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024G13Rik T A 14: 32,388,312 Y14F probably damaging Het
2410131K14Rik A G 5: 118,255,694 N46D probably benign Het
4930563D23Rik T C 16: 92,320,987 K138E probably benign Het
Acly A G 11: 100,483,782 V805A possibly damaging Het
AF366264 T A 8: 13,837,996 I32L probably benign Het
Apcdd1 T C 18: 62,951,845 V371A probably damaging Het
Cacna1g A T 11: 94,465,930 F127I probably benign Het
Ccdc129 T C 6: 55,897,686 I207T probably damaging Het
Ccdc138 T C 10: 58,538,280 L374P probably damaging Het
Ces2b A G 8: 104,838,296 Y504C probably damaging Het
Ces5a C T 8: 93,502,322 G427S probably damaging Het
Chd1l C T 3: 97,591,316 V256M probably damaging Het
Col24a1 C T 3: 145,315,299 T477M probably damaging Het
Dmbt1 T A 7: 131,066,734 C573* probably null Het
Emcn A T 3: 137,417,094 Y188F possibly damaging Het
Eva1a T G 6: 82,071,144 M1R probably null Het
Fam83h C A 15: 76,005,167 D194Y probably damaging Het
Flywch1 T C 17: 23,755,675 K664E probably benign Het
Gm21964 G T 8: 110,109,416 R119I probably benign Het
Heatr5b T C 17: 78,831,434 D93G probably damaging Het
Hmcn1 T C 1: 150,686,854 I2318V probably benign Het
Hyal5 T A 6: 24,876,902 L258Q probably damaging Het
Kmo T A 1: 175,651,602 C235S probably damaging Het
Lamc2 G A 1: 153,185,984 P2S probably benign Het
Lman2 G A 13: 55,352,949 P146S probably benign Het
Mars2 T C 1: 55,237,514 I92T probably damaging Het
Msh3 A G 13: 92,354,822 F27L probably benign Het
Myom2 T C 8: 15,084,577 V460A possibly damaging Het
Nicn1 T A 9: 108,295,107 *214R probably null Het
Nsd2 T C 5: 33,885,511 F1040L possibly damaging Het
Olfr374 T A 8: 72,110,157 I197N possibly damaging Het
Osm T A 11: 4,239,936 I240N probably benign Het
Pard3b T A 1: 62,440,032 D884E probably benign Het
Pex5 T G 6: 124,405,272 D150A probably benign Het
Pfkfb4 T C 9: 109,027,608 V394A probably damaging Het
Pjvk A G 2: 76,658,487 K334R possibly damaging Het
Pkd1l2 T C 8: 117,080,786 D171G probably benign Het
Prpf4b T G 13: 34,894,472 N688K probably benign Het
R3hcc1 T C 14: 69,705,552 E192G possibly damaging Het
Rad54l2 C A 9: 106,719,119 G207* probably null Het
Rhobtb3 G T 13: 75,910,887 T264K probably benign Het
Rpl27 A G 11: 101,442,406 probably benign Het
Rxfp3 C T 15: 11,036,777 V170I possibly damaging Het
Samd4 T A 14: 47,016,683 S201R probably benign Het
Sell A G 1: 164,065,607 I131V possibly damaging Het
Sirpb1c A T 3: 15,833,059 Y205* probably null Het
Smc3 A T 19: 53,641,895 E1111V possibly damaging Het
Sowaha C A 11: 53,479,355 V185L probably benign Het
Spata4 A C 8: 54,602,550 I159L probably benign Het
Tekt2 A G 4: 126,322,381 I373T probably benign Het
Tomm20l T C 12: 71,117,539 V65A probably benign Het
Trabd2b A G 4: 114,409,350 D187G probably damaging Het
Trrap A G 5: 144,821,803 I2147V possibly damaging Het
Tsc22d2 T A 3: 58,417,008 C440* probably null Het
Ube3b A C 5: 114,406,252 N570T probably damaging Het
Uevld A G 7: 46,950,976 I70T probably damaging Het
Usp10 C T 8: 119,936,550 T37I possibly damaging Het
Vmn2r23 T A 6: 123,713,022 F286I probably benign Het
Vmn2r62 A G 7: 42,765,216 V601A probably benign Het
Wdr81 G C 11: 75,446,002 N401K Het
Ythdc2 G T 18: 44,833,122 V142F probably benign Het
Zfp346 T C 13: 55,105,450 F36S possibly damaging Het
Zfp748 C T 13: 67,542,239 V301M possibly damaging Het
Zim1 T C 7: 6,678,221 K148E possibly damaging Het
Other mutations in Fzd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Fzd9 APN 5 135249469 missense probably damaging 1.00
IGL01446:Fzd9 APN 5 135250566 missense probably damaging 1.00
IGL02510:Fzd9 APN 5 135249615 missense probably damaging 1.00
R0308:Fzd9 UTSW 5 135249406 missense probably damaging 0.97
R0417:Fzd9 UTSW 5 135249619 missense probably damaging 0.99
R1563:Fzd9 UTSW 5 135250554 missense probably damaging 0.96
R1638:Fzd9 UTSW 5 135249748 missense probably damaging 1.00
R1840:Fzd9 UTSW 5 135249571 missense probably benign
R2046:Fzd9 UTSW 5 135249684 missense probably damaging 1.00
R2268:Fzd9 UTSW 5 135250294 missense probably damaging 1.00
R2898:Fzd9 UTSW 5 135249846 missense probably damaging 1.00
R4078:Fzd9 UTSW 5 135249636 missense probably benign 0.01
R4079:Fzd9 UTSW 5 135249636 missense probably benign 0.01
R4576:Fzd9 UTSW 5 135250312 missense probably damaging 1.00
R4662:Fzd9 UTSW 5 135249621 missense probably damaging 1.00
R4956:Fzd9 UTSW 5 135249942 missense probably damaging 1.00
R5096:Fzd9 UTSW 5 135249859 missense probably damaging 0.96
R5227:Fzd9 UTSW 5 135249606 missense probably benign 0.06
R5452:Fzd9 UTSW 5 135250860 missense probably damaging 1.00
R5475:Fzd9 UTSW 5 135250269 unclassified probably null
R5888:Fzd9 UTSW 5 135249463 unclassified probably null
R5914:Fzd9 UTSW 5 135249345 missense probably benign
R7544:Fzd9 UTSW 5 135249862 missense probably damaging 1.00
X0063:Fzd9 UTSW 5 135249721 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CCAAGGACATGAAGATTTTGAGC -3'
(R):5'- CTGACTGGGCTCTGCTATGTAG -3'

Sequencing Primer
(F):5'- TTTTGAGCATGAAGACAGCCAC -3'
(R):5'- TATGTAGCCAGCATGGACCC -3'
Posted On2019-05-15