Incidental Mutation 'R7148:Dmbt1'
ID553945
Institutional Source Beutler Lab
Gene Symbol Dmbt1
Ensembl Gene ENSMUSG00000047517
Gene Namedeleted in malignant brain tumors 1
SynonymsCRP-[a], Crpd, gp300, vomeroglandin, CRP-[b], ebnerin, MUCLIN, hensin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.206) question?
Stock #R7148 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location131032053-131121630 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 131066734 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 573 (C573*)
Ref Sequence ENSEMBL: ENSMUSP00000146685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084509] [ENSMUST00000124096] [ENSMUST00000208311] [ENSMUST00000213064]
Predicted Effect probably null
Transcript: ENSMUST00000084509
AA Change: C562*
SMART Domains Protein: ENSMUSP00000081556
Gene: ENSMUSG00000047517
AA Change: C562*

DomainStartEndE-ValueType
SR 37 137 5.54e-59 SMART
SR 186 286 3.6e-58 SMART
SR 324 424 1.21e-59 SMART
SR 463 563 2.97e-59 SMART
SR 602 702 3.36e-58 SMART
SR 741 841 5.17e-59 SMART
low complexity region 848 879 N/A INTRINSIC
CUB 884 993 4.22e-41 SMART
CUB 1000 1109 7.35e-41 SMART
CUB 1126 1235 3.73e-42 SMART
CUB 1242 1351 2.02e-38 SMART
SR 1371 1471 3.92e-59 SMART
low complexity region 1476 1488 N/A INTRINSIC
CUB 1494 1603 6.7e-44 SMART
ZP 1612 1860 8.11e-74 SMART
transmembrane domain 1906 1928 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000208311
AA Change: C573*
Predicted Effect probably benign
Transcript: ENSMUST00000213064
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Loss of sequences from human chromosome 10q has been associated with the progression of human cancers. This gene was originally isolated based on its deletion in a medulloblastoma cell line. This gene is expressed with transcripts of 6.0, 7.5, and 8.0 kb in fetal lung and with one transcript of 8.0 kb in adult lung, although the 7.5 kb transcript has not been characterized. The encoded protein precursor is a glycoprotein containing multiple scavenger receptor cysteine-rich (SRCR) domains separated by SRCR-interspersed domains (SID). Transcript variant 2 (8.0 kb) has been shown to bind surfactant protein D independently of carbohydrate recognition. This indicates that DMBT1 may not be a classical tumor suppressor gene, but rather play a role in the interaction of tumor cells and the immune system. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for one null allele display embryonic lethality and an abnormal inner cell mass. Mice homozygous for a different null allele are viable and fertile with an increased susceptibility to induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024G13Rik T A 14: 32,388,312 Y14F probably damaging Het
2410131K14Rik A G 5: 118,255,694 N46D probably benign Het
4930563D23Rik T C 16: 92,320,987 K138E probably benign Het
Acly A G 11: 100,483,782 V805A possibly damaging Het
AF366264 T A 8: 13,837,996 I32L probably benign Het
Apcdd1 T C 18: 62,951,845 V371A probably damaging Het
Cacna1g A T 11: 94,465,930 F127I probably benign Het
Ccdc129 T C 6: 55,897,686 I207T probably damaging Het
Ccdc138 T C 10: 58,538,280 L374P probably damaging Het
Ces2b A G 8: 104,838,296 Y504C probably damaging Het
Ces5a C T 8: 93,502,322 G427S probably damaging Het
Chd1l C T 3: 97,591,316 V256M probably damaging Het
Col24a1 C T 3: 145,315,299 T477M probably damaging Het
Emcn A T 3: 137,417,094 Y188F possibly damaging Het
Eva1a T G 6: 82,071,144 M1R probably null Het
Fam83h C A 15: 76,005,167 D194Y probably damaging Het
Flywch1 T C 17: 23,755,675 K664E probably benign Het
Fzd9 A G 5: 135,249,690 V447A probably benign Het
Gm21964 G T 8: 110,109,416 R119I probably benign Het
Heatr5b T C 17: 78,831,434 D93G probably damaging Het
Hmcn1 T C 1: 150,686,854 I2318V probably benign Het
Hyal5 T A 6: 24,876,902 L258Q probably damaging Het
Kmo T A 1: 175,651,602 C235S probably damaging Het
Lamc2 G A 1: 153,185,984 P2S probably benign Het
Lman2 G A 13: 55,352,949 P146S probably benign Het
Mars2 T C 1: 55,237,514 I92T probably damaging Het
Msh3 A G 13: 92,354,822 F27L probably benign Het
Myom2 T C 8: 15,084,577 V460A possibly damaging Het
Nicn1 T A 9: 108,295,107 *214R probably null Het
Nsd2 T C 5: 33,885,511 F1040L possibly damaging Het
Olfr374 T A 8: 72,110,157 I197N possibly damaging Het
Osm T A 11: 4,239,936 I240N probably benign Het
Pard3b T A 1: 62,440,032 D884E probably benign Het
Pex5 T G 6: 124,405,272 D150A probably benign Het
Pfkfb4 T C 9: 109,027,608 V394A probably damaging Het
Pjvk A G 2: 76,658,487 K334R possibly damaging Het
Pkd1l2 T C 8: 117,080,786 D171G probably benign Het
Prpf4b T G 13: 34,894,472 N688K probably benign Het
R3hcc1 T C 14: 69,705,552 E192G possibly damaging Het
Rad54l2 C A 9: 106,719,119 G207* probably null Het
Rhobtb3 G T 13: 75,910,887 T264K probably benign Het
Rpl27 A G 11: 101,442,406 probably benign Het
Rxfp3 C T 15: 11,036,777 V170I possibly damaging Het
Samd4 T A 14: 47,016,683 S201R probably benign Het
Sell A G 1: 164,065,607 I131V possibly damaging Het
Sirpb1c A T 3: 15,833,059 Y205* probably null Het
Smc3 A T 19: 53,641,895 E1111V possibly damaging Het
Sowaha C A 11: 53,479,355 V185L probably benign Het
Spata4 A C 8: 54,602,550 I159L probably benign Het
Tekt2 A G 4: 126,322,381 I373T probably benign Het
Tomm20l T C 12: 71,117,539 V65A probably benign Het
Trabd2b A G 4: 114,409,350 D187G probably damaging Het
Trrap A G 5: 144,821,803 I2147V possibly damaging Het
Tsc22d2 T A 3: 58,417,008 C440* probably null Het
Ube3b A C 5: 114,406,252 N570T probably damaging Het
Uevld A G 7: 46,950,976 I70T probably damaging Het
Usp10 C T 8: 119,936,550 T37I possibly damaging Het
Vmn2r23 T A 6: 123,713,022 F286I probably benign Het
Vmn2r62 A G 7: 42,765,216 V601A probably benign Het
Wdr81 G C 11: 75,446,002 N401K Het
Ythdc2 G T 18: 44,833,122 V142F probably benign Het
Zfp346 T C 13: 55,105,450 F36S possibly damaging Het
Zfp748 C T 13: 67,542,239 V301M possibly damaging Het
Zim1 T C 7: 6,678,221 K148E possibly damaging Het
Other mutations in Dmbt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Dmbt1 APN 7 131079540 intron probably benign
IGL00161:Dmbt1 APN 7 131109628 missense probably damaging 1.00
IGL00331:Dmbt1 APN 7 131099290 missense possibly damaging 0.46
IGL00769:Dmbt1 APN 7 131082500 missense probably damaging 0.99
IGL00792:Dmbt1 APN 7 131097607 missense possibly damaging 0.66
IGL00823:Dmbt1 APN 7 131058158 missense probably benign 0.26
IGL01072:Dmbt1 APN 7 131085368 splice site probably benign
IGL01317:Dmbt1 APN 7 131041191 missense probably damaging 1.00
IGL01335:Dmbt1 APN 7 131088767 missense possibly damaging 0.95
IGL01372:Dmbt1 APN 7 131103679 missense possibly damaging 0.90
IGL01511:Dmbt1 APN 7 131116728 missense possibly damaging 0.49
IGL01627:Dmbt1 APN 7 131081185 missense probably benign 0.14
IGL01890:Dmbt1 APN 7 131074419 intron probably benign
IGL02160:Dmbt1 APN 7 131082688 missense probably damaging 1.00
IGL02186:Dmbt1 APN 7 131093256 splice site probably benign
IGL02197:Dmbt1 APN 7 131085422 splice site probably benign
IGL02332:Dmbt1 APN 7 131066613 intron probably benign
IGL02427:Dmbt1 APN 7 131088085 splice site probably null
IGL02726:Dmbt1 APN 7 131074410 intron probably benign
IGL02967:Dmbt1 APN 7 131071189 missense possibly damaging 0.70
IGL03003:Dmbt1 APN 7 131082679 missense probably benign 0.05
IGL03089:Dmbt1 APN 7 131111049 missense probably damaging 0.99
H8562:Dmbt1 UTSW 7 131112076 nonsense probably null
K3955:Dmbt1 UTSW 7 131119564 missense probably damaging 0.98
R0051:Dmbt1 UTSW 7 131119496 missense possibly damaging 0.79
R0051:Dmbt1 UTSW 7 131119496 missense possibly damaging 0.79
R0257:Dmbt1 UTSW 7 131106393 missense probably damaging 1.00
R0388:Dmbt1 UTSW 7 131096049 splice site probably benign
R0427:Dmbt1 UTSW 7 131040902 nonsense probably null
R0478:Dmbt1 UTSW 7 131041187 missense possibly damaging 0.93
R0502:Dmbt1 UTSW 7 131097673 splice site probably null
R0538:Dmbt1 UTSW 7 131049901 splice site probably benign
R0626:Dmbt1 UTSW 7 131102081 missense probably damaging 0.97
R0631:Dmbt1 UTSW 7 131097653 missense possibly damaging 0.90
R0948:Dmbt1 UTSW 7 131093117 missense possibly damaging 0.95
R1169:Dmbt1 UTSW 7 131074524 critical splice donor site probably null
R1413:Dmbt1 UTSW 7 131050214 missense probably damaging 1.00
R1458:Dmbt1 UTSW 7 131044487 splice site probably benign
R1463:Dmbt1 UTSW 7 131109637 critical splice donor site probably null
R1509:Dmbt1 UTSW 7 131074331 intron probably benign
R1990:Dmbt1 UTSW 7 131058288 missense probably damaging 0.98
R2018:Dmbt1 UTSW 7 131110989 missense possibly damaging 0.93
R2019:Dmbt1 UTSW 7 131110989 missense possibly damaging 0.93
R2042:Dmbt1 UTSW 7 131106359 missense probably damaging 0.99
R2056:Dmbt1 UTSW 7 131106170 missense possibly damaging 0.80
R2057:Dmbt1 UTSW 7 131106170 missense possibly damaging 0.80
R2058:Dmbt1 UTSW 7 131106170 missense possibly damaging 0.80
R2059:Dmbt1 UTSW 7 131106170 missense possibly damaging 0.80
R2061:Dmbt1 UTSW 7 131099133 missense possibly damaging 0.66
R2092:Dmbt1 UTSW 7 131050018 missense probably damaging 1.00
R2102:Dmbt1 UTSW 7 131102032 missense probably damaging 0.97
R2155:Dmbt1 UTSW 7 131097575 missense possibly damaging 0.66
R2243:Dmbt1 UTSW 7 131046562 missense probably benign 0.03
R2256:Dmbt1 UTSW 7 131090494 missense probably benign 0.01
R2391:Dmbt1 UTSW 7 131106468 missense probably damaging 1.00
R2394:Dmbt1 UTSW 7 131094734 nonsense probably null
R3014:Dmbt1 UTSW 7 131032097 intron probably benign
R3155:Dmbt1 UTSW 7 131050157 nonsense probably null
R3176:Dmbt1 UTSW 7 131088071 missense probably benign 0.19
R3276:Dmbt1 UTSW 7 131088071 missense probably benign 0.19
R3442:Dmbt1 UTSW 7 131106249 missense probably damaging 1.00
R3807:Dmbt1 UTSW 7 131112090 missense possibly damaging 0.77
R4060:Dmbt1 UTSW 7 131074202 intron probably benign
R4396:Dmbt1 UTSW 7 131116632 missense probably damaging 0.98
R4453:Dmbt1 UTSW 7 131040934 missense probably damaging 1.00
R5001:Dmbt1 UTSW 7 131050012 missense probably damaging 1.00
R5051:Dmbt1 UTSW 7 131094742 missense probably benign 0.01
R5156:Dmbt1 UTSW 7 131097670 critical splice donor site probably null
R5225:Dmbt1 UTSW 7 131094735 missense possibly damaging 0.84
R5281:Dmbt1 UTSW 7 131082619 missense probably damaging 1.00
R5308:Dmbt1 UTSW 7 131041021 missense probably damaging 1.00
R5447:Dmbt1 UTSW 7 131119511 missense probably damaging 0.99
R5467:Dmbt1 UTSW 7 131040993 missense probably damaging 1.00
R5497:Dmbt1 UTSW 7 131063403 intron probably benign
R5526:Dmbt1 UTSW 7 131041190 missense probably damaging 1.00
R5554:Dmbt1 UTSW 7 131099300 nonsense probably null
R5566:Dmbt1 UTSW 7 131106273 missense probably damaging 1.00
R5595:Dmbt1 UTSW 7 131054067 missense probably benign 0.17
R6154:Dmbt1 UTSW 7 131109641 splice site probably null
R6188:Dmbt1 UTSW 7 131097631 missense probably damaging 0.97
R6214:Dmbt1 UTSW 7 131066733 missense possibly damaging 0.95
R6215:Dmbt1 UTSW 7 131066733 missense possibly damaging 0.95
R6391:Dmbt1 UTSW 7 131058254 missense probably damaging 1.00
R6397:Dmbt1 UTSW 7 131103578 missense possibly damaging 0.46
R6436:Dmbt1 UTSW 7 131116641 missense probably benign 0.01
R6603:Dmbt1 UTSW 7 131046510 intron probably null
R6719:Dmbt1 UTSW 7 131119603 missense possibly damaging 0.83
R6781:Dmbt1 UTSW 7 131046561 missense probably benign 0.16
R7191:Dmbt1 UTSW 7 131044520 missense unknown
R7269:Dmbt1 UTSW 7 131066621 missense unknown
R7288:Dmbt1 UTSW 7 131083789 nonsense probably null
R7296:Dmbt1 UTSW 7 131112132 missense unknown
R7349:Dmbt1 UTSW 7 131041124 missense unknown
R7386:Dmbt1 UTSW 7 131112236 missense unknown
R7428:Dmbt1 UTSW 7 131108463 missense possibly damaging 0.53
R7481:Dmbt1 UTSW 7 131079511 critical splice acceptor site probably null
R7486:Dmbt1 UTSW 7 131066462 missense unknown
X0024:Dmbt1 UTSW 7 131112248 nonsense probably null
X0062:Dmbt1 UTSW 7 131094851 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- GGAGATCCTTTACCAGGGTTCC -3'
(R):5'- TAGAGACTGAGAGCCTTGGG -3'

Sequencing Primer
(F):5'- CTCAATGATGCCAACGTGGTG -3'
(R):5'- TTGGGCAGGACCATGACTG -3'
Posted On2019-05-15