Incidental Mutation 'R7148:Apcdd1'
ID553981
Institutional Source Beutler Lab
Gene Symbol Apcdd1
Ensembl Gene ENSMUSG00000071847
Gene Nameadenomatosis polyposis coli down-regulated 1
SynonymsDrapc1, EIG180
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R7148 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location62922327-62953195 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62951845 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 371 (V371A)
Ref Sequence ENSEMBL: ENSMUSP00000094302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096554] [ENSMUST00000163716]
Predicted Effect probably damaging
Transcript: ENSMUST00000096554
AA Change: V371A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000094302
Gene: ENSMUSG00000071847
AA Change: V371A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
APCDDC 51 283 3.3e-140 SMART
APCDDC 284 500 6.26e-91 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163716
AA Change: V371A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125868
Gene: ENSMUSG00000071847
AA Change: V371A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
APCDDC 51 283 3.3e-140 SMART
APCDDC 284 500 6.26e-91 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an inhibitor of the Wnt signaling pathway. Mutations at this locus have been associated with hereditary hypotrichosis simplex. Increased expression of this gene may also be associated with colorectal carcinogenesis.[provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024G13Rik T A 14: 32,388,312 Y14F probably damaging Het
2410131K14Rik A G 5: 118,255,694 N46D probably benign Het
4930563D23Rik T C 16: 92,320,987 K138E probably benign Het
Acly A G 11: 100,483,782 V805A possibly damaging Het
AF366264 T A 8: 13,837,996 I32L probably benign Het
Cacna1g A T 11: 94,465,930 F127I probably benign Het
Ccdc129 T C 6: 55,897,686 I207T probably damaging Het
Ccdc138 T C 10: 58,538,280 L374P probably damaging Het
Ces2b A G 8: 104,838,296 Y504C probably damaging Het
Ces5a C T 8: 93,502,322 G427S probably damaging Het
Chd1l C T 3: 97,591,316 V256M probably damaging Het
Col24a1 C T 3: 145,315,299 T477M probably damaging Het
Dmbt1 T A 7: 131,066,734 C573* probably null Het
Emcn A T 3: 137,417,094 Y188F possibly damaging Het
Eva1a T G 6: 82,071,144 M1R probably null Het
Fam83h C A 15: 76,005,167 D194Y probably damaging Het
Flywch1 T C 17: 23,755,675 K664E probably benign Het
Fzd9 A G 5: 135,249,690 V447A probably benign Het
Gm21964 G T 8: 110,109,416 R119I probably benign Het
Heatr5b T C 17: 78,831,434 D93G probably damaging Het
Hmcn1 T C 1: 150,686,854 I2318V probably benign Het
Hyal5 T A 6: 24,876,902 L258Q probably damaging Het
Kmo T A 1: 175,651,602 C235S probably damaging Het
Lamc2 G A 1: 153,185,984 P2S probably benign Het
Lman2 G A 13: 55,352,949 P146S probably benign Het
Mars2 T C 1: 55,237,514 I92T probably damaging Het
Msh3 A G 13: 92,354,822 F27L probably benign Het
Myom2 T C 8: 15,084,577 V460A possibly damaging Het
Nicn1 T A 9: 108,295,107 *214R probably null Het
Nsd2 T C 5: 33,885,511 F1040L possibly damaging Het
Olfr374 T A 8: 72,110,157 I197N possibly damaging Het
Osm T A 11: 4,239,936 I240N probably benign Het
Pard3b T A 1: 62,440,032 D884E probably benign Het
Pex5 T G 6: 124,405,272 D150A probably benign Het
Pfkfb4 T C 9: 109,027,608 V394A probably damaging Het
Pjvk A G 2: 76,658,487 K334R possibly damaging Het
Pkd1l2 T C 8: 117,080,786 D171G probably benign Het
Prpf4b T G 13: 34,894,472 N688K probably benign Het
R3hcc1 T C 14: 69,705,552 E192G possibly damaging Het
Rad54l2 C A 9: 106,719,119 G207* probably null Het
Rhobtb3 G T 13: 75,910,887 T264K probably benign Het
Rpl27 A G 11: 101,442,406 probably benign Het
Rxfp3 C T 15: 11,036,777 V170I possibly damaging Het
Samd4 T A 14: 47,016,683 S201R probably benign Het
Sell A G 1: 164,065,607 I131V possibly damaging Het
Sirpb1c A T 3: 15,833,059 Y205* probably null Het
Smc3 A T 19: 53,641,895 E1111V possibly damaging Het
Sowaha C A 11: 53,479,355 V185L probably benign Het
Spata4 A C 8: 54,602,550 I159L probably benign Het
Tekt2 A G 4: 126,322,381 I373T probably benign Het
Tomm20l T C 12: 71,117,539 V65A probably benign Het
Trabd2b A G 4: 114,409,350 D187G probably damaging Het
Trrap A G 5: 144,821,803 I2147V possibly damaging Het
Tsc22d2 T A 3: 58,417,008 C440* probably null Het
Ube3b A C 5: 114,406,252 N570T probably damaging Het
Uevld A G 7: 46,950,976 I70T probably damaging Het
Usp10 C T 8: 119,936,550 T37I possibly damaging Het
Vmn2r23 T A 6: 123,713,022 F286I probably benign Het
Vmn2r62 A G 7: 42,765,216 V601A probably benign Het
Wdr81 G C 11: 75,446,002 N401K Het
Ythdc2 G T 18: 44,833,122 V142F probably benign Het
Zfp346 T C 13: 55,105,450 F36S possibly damaging Het
Zfp748 C T 13: 67,542,239 V301M possibly damaging Het
Zim1 T C 7: 6,678,221 K148E possibly damaging Het
Other mutations in Apcdd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00805:Apcdd1 APN 18 62933865 splice site probably benign
IGL01522:Apcdd1 APN 18 62952115 missense possibly damaging 0.50
IGL01637:Apcdd1 APN 18 62937286 missense probably damaging 1.00
IGL02069:Apcdd1 APN 18 62949983 missense probably damaging 1.00
IGL02183:Apcdd1 APN 18 62951854 missense probably damaging 0.98
IGL02268:Apcdd1 APN 18 62950188 missense probably damaging 0.99
IGL02664:Apcdd1 APN 18 62951820 splice site probably benign
R0207:Apcdd1 UTSW 18 62950079 missense probably benign 0.04
R0363:Apcdd1 UTSW 18 62937097 missense possibly damaging 0.46
R0540:Apcdd1 UTSW 18 62951896 missense possibly damaging 0.82
R0567:Apcdd1 UTSW 18 62934036 missense possibly damaging 0.93
R0607:Apcdd1 UTSW 18 62951896 missense possibly damaging 0.82
R0629:Apcdd1 UTSW 18 62933970 missense probably damaging 1.00
R1118:Apcdd1 UTSW 18 62952024 missense probably benign
R1178:Apcdd1 UTSW 18 62937097 missense probably damaging 1.00
R1180:Apcdd1 UTSW 18 62937097 missense probably damaging 1.00
R1181:Apcdd1 UTSW 18 62937097 missense probably damaging 1.00
R4363:Apcdd1 UTSW 18 62951932 missense possibly damaging 0.95
R5534:Apcdd1 UTSW 18 62937034 missense probably benign 0.01
R5622:Apcdd1 UTSW 18 62936902 splice site probably null
R5771:Apcdd1 UTSW 18 62936956 missense probably damaging 1.00
R5852:Apcdd1 UTSW 18 62937063 missense probably damaging 1.00
R5934:Apcdd1 UTSW 18 62951869 missense possibly damaging 0.72
R6109:Apcdd1 UTSW 18 62937366 missense probably damaging 1.00
R6515:Apcdd1 UTSW 18 62951839 missense probably damaging 1.00
R6625:Apcdd1 UTSW 18 62951858 missense probably damaging 1.00
R6831:Apcdd1 UTSW 18 62950126 nonsense probably null
R6931:Apcdd1 UTSW 18 62933908 missense probably damaging 1.00
R7018:Apcdd1 UTSW 18 62937049 missense probably damaging 0.98
R7115:Apcdd1 UTSW 18 62936953 missense probably damaging 1.00
R7326:Apcdd1 UTSW 18 62952188 nonsense probably null
X0028:Apcdd1 UTSW 18 62937130 missense possibly damaging 0.59
Z1088:Apcdd1 UTSW 18 62937183 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- GCATATGGAACTTCCTACCAGAG -3'
(R):5'- GCCATTGAACAGCAGGTAGC -3'

Sequencing Primer
(F):5'- TATGGAACTTCCTACCAGAGCCTAC -3'
(R):5'- GGTGTCTTGCTCCATTTTGAAGATC -3'
Posted On2019-05-15