Incidental Mutation 'R7149:Zfp451'
ID553983
Institutional Source Beutler Lab
Gene Symbol Zfp451
Ensembl Gene ENSMUSG00000042197
Gene Namezinc finger protein 451
Synonyms4930515K21Rik, Kiaa0576-hp, 4933435G09Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7149 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location33761545-33814595 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 33777324 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 515 (R515Q)
Ref Sequence ENSEMBL: ENSMUSP00000019861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019861] [ENSMUST00000115167] [ENSMUST00000139143] [ENSMUST00000151055] [ENSMUST00000194656]
Predicted Effect probably damaging
Transcript: ENSMUST00000019861
AA Change: R515Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019861
Gene: ENSMUSG00000042197
AA Change: R515Q

DomainStartEndE-ValueType
coiled coil region 81 109 N/A INTRINSIC
ZnF_C2H2 169 195 1.63e1 SMART
ZnF_C2H2 212 232 1.18e2 SMART
ZnF_C2H2 253 277 1.73e0 SMART
ZnF_C2H2 315 335 2.03e2 SMART
ZnF_C2H2 362 385 3.75e1 SMART
ZnF_C2H2 494 517 2.91e-2 SMART
ZnF_C2H2 527 550 5.4e1 SMART
low complexity region 558 577 N/A INTRINSIC
ZnF_C2H2 604 629 1.55e1 SMART
ZnF_C2H2 634 657 2.29e0 SMART
ZnF_C2H2 665 687 1.64e-1 SMART
ZnF_C2H2 751 774 6.75e0 SMART
ZnF_C2H2 787 810 4.94e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115167
SMART Domains Protein: ENSMUSP00000110821
Gene: ENSMUSG00000042197

DomainStartEndE-ValueType
coiled coil region 81 109 N/A INTRINSIC
ZnF_C2H2 169 195 1.63e1 SMART
ZnF_C2H2 212 232 1.18e2 SMART
ZnF_C2H2 253 277 1.73e0 SMART
ZnF_C2H2 315 335 2.03e2 SMART
ZnF_C2H2 362 385 3.75e1 SMART
ZnF_C2H2 494 517 2.91e-2 SMART
ZnF_C2H2 527 550 5.4e1 SMART
low complexity region 558 577 N/A INTRINSIC
ZnF_C2H2 604 629 1.55e1 SMART
ZnF_C2H2 634 657 2.29e0 SMART
ZnF_C2H2 665 687 1.64e-1 SMART
ZnF_C2H2 751 774 6.75e0 SMART
ZnF_C2H2 787 810 4.94e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139143
Predicted Effect probably benign
Transcript: ENSMUST00000151055
Predicted Effect probably benign
Transcript: ENSMUST00000194656
SMART Domains Protein: ENSMUSP00000141813
Gene: ENSMUSG00000042197

DomainStartEndE-ValueType
ZnF_C2H2 127 153 6.9e-2 SMART
ZnF_C2H2 170 190 5e-1 SMART
ZnF_C2H2 211 235 7.2e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik G A 1: 37,612,271 Q1172* probably null Het
Acly A C 11: 100,484,625 F790V probably damaging Het
Atf4 AAGCGGGCTGAGC AAGC 15: 80,257,299 probably benign Het
Brd8 C T 18: 34,604,597 probably null Het
Bsn A T 9: 108,116,321 L744* probably null Het
Capn9 A G 8: 124,605,709 D429G probably benign Het
CK137956 A T 4: 127,970,833 M1K probably null Het
Cnot6 G A 11: 49,680,143 P341S probably benign Het
Ddx58 T C 4: 40,222,079 D445G possibly damaging Het
Dld T G 12: 31,335,590 I251L probably benign Het
Dlg5 T C 14: 24,190,424 K253R probably benign Het
Dnmt3a C T 12: 3,902,397 P696L probably damaging Het
Dph1 T C 11: 75,179,175 K409E probably benign Het
Dsg2 T C 18: 20,579,454 S172P probably damaging Het
Gm1979 T C 5: 26,001,947 N136S probably benign Het
Gm2663 A T 6: 40,997,957 L60Q probably damaging Het
Gm5724 A G 6: 141,744,452 S192P probably damaging Het
Hdac10 A G 15: 89,127,449 F144S probably damaging Het
Ifi203 T C 1: 173,928,928 T430A unknown Het
Itgb2l T C 16: 96,433,559 D244G probably damaging Het
Klk1b9 A T 7: 43,979,417 Y115F probably benign Het
Llcfc1 C A 6: 41,685,317 A85E possibly damaging Het
Lrp1b C T 2: 40,637,860 V4330M Het
Map3k13 A G 16: 21,925,437 E811G probably benign Het
Myl6b A G 10: 128,497,199 probably null Het
Myo15 G A 11: 60,510,010 A2997T possibly damaging Het
Nalcn T C 14: 123,599,865 D29G probably benign Het
Nepro T A 16: 44,729,715 probably null Het
Nlrp1b T A 11: 71,181,656 R454* probably null Het
Nlrp4a T C 7: 26,450,438 V490A probably benign Het
Olfr166 T C 16: 19,487,510 V224A probably damaging Het
Olfr397 G A 11: 73,965,431 M274I probably benign Het
Pde8b T G 13: 95,086,841 M197L probably benign Het
Phldb2 T A 16: 45,751,532 K1166* probably null Het
Plekhm1 A G 11: 103,394,916 I231T probably damaging Het
Ppp6r2 T C 15: 89,262,396 I199T probably damaging Het
Ptch1 G T 13: 63,511,736 H1368N probably benign Het
Ptprj T A 2: 90,444,446 T1191S possibly damaging Het
Rapgef1 T C 2: 29,720,700 S748P probably damaging Het
Rnmt T C 18: 68,319,151 S420P probably damaging Het
Sgms2 A G 3: 131,336,259 F160S possibly damaging Het
Sim1 G T 10: 50,909,540 R235L probably damaging Het
Smarcad1 T A 6: 65,052,732 D101E probably benign Het
Smarcc2 G A 10: 128,482,729 V627M probably damaging Het
Supt20 G A 3: 54,728,411 R241H unknown Het
Tagln2 T A 1: 172,505,819 I80N probably damaging Het
Tmod2 G A 9: 75,581,885 T226I possibly damaging Het
Vmn2r80 A T 10: 79,194,820 I827F probably benign Het
Vmn2r96 T A 17: 18,597,727 M714K possibly damaging Het
Vps8 C A 16: 21,459,776 D261E probably damaging Het
Yeats2 C A 16: 20,154,189 A31E probably damaging Het
Zfp553 A G 7: 127,236,433 S387G possibly damaging Het
Other mutations in Zfp451
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Zfp451 APN 1 33786540 intron probably benign
IGL00423:Zfp451 APN 1 33777579 missense probably benign 0.44
IGL00925:Zfp451 APN 1 33776261 unclassified probably benign
IGL00971:Zfp451 APN 1 33783153 missense probably benign 0.01
IGL01521:Zfp451 APN 1 33777331 unclassified probably null
IGL01672:Zfp451 APN 1 33762166 missense probably benign 0.33
IGL01826:Zfp451 APN 1 33782162 missense probably damaging 1.00
IGL02298:Zfp451 APN 1 33772921 missense probably damaging 0.98
IGL02343:Zfp451 APN 1 33776493 missense probably damaging 1.00
IGL03150:Zfp451 APN 1 33777454 missense probably damaging 1.00
IGL03257:Zfp451 APN 1 33777048 missense possibly damaging 0.90
R0006:Zfp451 UTSW 1 33802780 intron probably benign
R0068:Zfp451 UTSW 1 33777625 missense probably damaging 1.00
R0068:Zfp451 UTSW 1 33777625 missense probably damaging 1.00
R0358:Zfp451 UTSW 1 33777729 missense probably damaging 1.00
R0441:Zfp451 UTSW 1 33777045 missense probably damaging 0.96
R0483:Zfp451 UTSW 1 33770910 splice site probably benign
R0745:Zfp451 UTSW 1 33770848 nonsense probably null
R1469:Zfp451 UTSW 1 33769813 missense possibly damaging 0.93
R1469:Zfp451 UTSW 1 33769813 missense possibly damaging 0.93
R1486:Zfp451 UTSW 1 33777727 missense probably damaging 0.99
R1774:Zfp451 UTSW 1 33813768 missense probably benign 0.02
R1929:Zfp451 UTSW 1 33782193 missense probably damaging 1.00
R1929:Zfp451 UTSW 1 33783856 missense probably benign 0.12
R1933:Zfp451 UTSW 1 33777822 missense probably damaging 1.00
R2108:Zfp451 UTSW 1 33779167 missense possibly damaging 0.93
R2225:Zfp451 UTSW 1 33770907 splice site probably benign
R2372:Zfp451 UTSW 1 33780052 splice site probably null
R3923:Zfp451 UTSW 1 33779045 missense probably null 1.00
R4295:Zfp451 UTSW 1 33777755 missense probably damaging 0.99
R4409:Zfp451 UTSW 1 33777413 missense probably damaging 1.00
R4617:Zfp451 UTSW 1 33802671 intron probably benign
R4757:Zfp451 UTSW 1 33765858 missense probably damaging 0.98
R4777:Zfp451 UTSW 1 33782105 missense possibly damaging 0.80
R4906:Zfp451 UTSW 1 33805384 missense probably damaging 1.00
R4964:Zfp451 UTSW 1 33777861 missense probably damaging 1.00
R5128:Zfp451 UTSW 1 33802933 intron probably benign
R5129:Zfp451 UTSW 1 33802933 intron probably benign
R5383:Zfp451 UTSW 1 33813806 missense probably damaging 1.00
R5446:Zfp451 UTSW 1 33777528 missense probably damaging 1.00
R6154:Zfp451 UTSW 1 33803546 intron probably benign
R6228:Zfp451 UTSW 1 33803138 intron probably benign
R6272:Zfp451 UTSW 1 33803244 intron probably benign
R6296:Zfp451 UTSW 1 33769817 nonsense probably null
R6321:Zfp451 UTSW 1 33813735 missense probably damaging 1.00
R6445:Zfp451 UTSW 1 33773011 missense probably damaging 1.00
R6528:Zfp451 UTSW 1 33777781 missense probably damaging 1.00
R6562:Zfp451 UTSW 1 33762179 missense possibly damaging 0.90
R6739:Zfp451 UTSW 1 33803594 intron probably benign
R6911:Zfp451 UTSW 1 33803456 intron probably benign
R7042:Zfp451 UTSW 1 33777393 missense probably damaging 1.00
R7044:Zfp451 UTSW 1 33802167 intron probably benign
R7071:Zfp451 UTSW 1 33776744 missense possibly damaging 0.96
R7082:Zfp451 UTSW 1 33772891 critical splice donor site probably null
R7123:Zfp451 UTSW 1 33776869 missense probably damaging 1.00
R7179:Zfp451 UTSW 1 33802570 missense unknown
R7185:Zfp451 UTSW 1 33769893 missense probably damaging 1.00
R7228:Zfp451 UTSW 1 33803394 missense unknown
R7402:Zfp451 UTSW 1 33813762 missense probably benign
R7462:Zfp451 UTSW 1 33777013 missense probably damaging 1.00
R7488:Zfp451 UTSW 1 33779140 missense probably benign 0.22
R7507:Zfp451 UTSW 1 33769759 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGTCAGTATTCAAATGGCTCTCC -3'
(R):5'- GAAAGCCTTGGAGGTGCAAC -3'

Sequencing Primer
(F):5'- GTATTCAAATGGCTCTCCACAGAGG -3'
(R):5'- TGCAACTCGTGTGCAGAG -3'
Posted On2019-05-15