Incidental Mutation 'R7149:Klk1b9'
ID554000
Institutional Source Beutler Lab
Gene Symbol Klk1b9
Ensembl Gene ENSMUSG00000059042
Gene Namekallikrein 1-related peptidase b9
SynonymsKlk9, Egfbp3, mGk-9, Egfbp-3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R7149 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location43976061-43980376 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43979417 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 115 (Y115F)
Ref Sequence ENSEMBL: ENSMUSP00000080133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081399]
Predicted Effect probably benign
Transcript: ENSMUST00000081399
AA Change: Y115F

PolyPhen 2 Score 0.302 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000080133
Gene: ENSMUSG00000059042
AA Change: Y115F

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 24 253 1.54e-98 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. This gene is located in a cluster of several related kallikrein genes on chromosome 7. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik G A 1: 37,612,271 Q1172* probably null Het
Acly A C 11: 100,484,625 F790V probably damaging Het
Atf4 AAGCGGGCTGAGC AAGC 15: 80,257,299 probably benign Het
Brd8 C T 18: 34,604,597 probably null Het
Bsn A T 9: 108,116,321 L744* probably null Het
Capn9 A G 8: 124,605,709 D429G probably benign Het
CK137956 A T 4: 127,970,833 M1K probably null Het
Cnot6 G A 11: 49,680,143 P341S probably benign Het
Ddx58 T C 4: 40,222,079 D445G possibly damaging Het
Dld T G 12: 31,335,590 I251L probably benign Het
Dlg5 T C 14: 24,190,424 K253R probably benign Het
Dnmt3a C T 12: 3,902,397 P696L probably damaging Het
Dph1 T C 11: 75,179,175 K409E probably benign Het
Dsg2 T C 18: 20,579,454 S172P probably damaging Het
Gm1979 T C 5: 26,001,947 N136S probably benign Het
Gm2663 A T 6: 40,997,957 L60Q probably damaging Het
Gm5724 A G 6: 141,744,452 S192P probably damaging Het
Hdac10 A G 15: 89,127,449 F144S probably damaging Het
Ifi203 T C 1: 173,928,928 T430A unknown Het
Itgb2l T C 16: 96,433,559 D244G probably damaging Het
Llcfc1 C A 6: 41,685,317 A85E possibly damaging Het
Lrp1b C T 2: 40,637,860 V4330M Het
Map3k13 A G 16: 21,925,437 E811G probably benign Het
Myl6b A G 10: 128,497,199 probably null Het
Myo15 G A 11: 60,510,010 A2997T possibly damaging Het
Nalcn T C 14: 123,599,865 D29G probably benign Het
Nepro T A 16: 44,729,715 probably null Het
Nlrp1b T A 11: 71,181,656 R454* probably null Het
Nlrp4a T C 7: 26,450,438 V490A probably benign Het
Olfr166 T C 16: 19,487,510 V224A probably damaging Het
Olfr397 G A 11: 73,965,431 M274I probably benign Het
Pde8b T G 13: 95,086,841 M197L probably benign Het
Phldb2 T A 16: 45,751,532 K1166* probably null Het
Plekhm1 A G 11: 103,394,916 I231T probably damaging Het
Ppp6r2 T C 15: 89,262,396 I199T probably damaging Het
Ptch1 G T 13: 63,511,736 H1368N probably benign Het
Ptprj T A 2: 90,444,446 T1191S possibly damaging Het
Rapgef1 T C 2: 29,720,700 S748P probably damaging Het
Rnmt T C 18: 68,319,151 S420P probably damaging Het
Sgms2 A G 3: 131,336,259 F160S possibly damaging Het
Sim1 G T 10: 50,909,540 R235L probably damaging Het
Smarcad1 T A 6: 65,052,732 D101E probably benign Het
Smarcc2 G A 10: 128,482,729 V627M probably damaging Het
Supt20 G A 3: 54,728,411 R241H unknown Het
Tagln2 T A 1: 172,505,819 I80N probably damaging Het
Tmod2 G A 9: 75,581,885 T226I possibly damaging Het
Vmn2r80 A T 10: 79,194,820 I827F probably benign Het
Vmn2r96 T A 17: 18,597,727 M714K possibly damaging Het
Vps8 C A 16: 21,459,776 D261E probably damaging Het
Yeats2 C A 16: 20,154,189 A31E probably damaging Het
Zfp451 C T 1: 33,777,324 R515Q probably damaging Het
Zfp553 A G 7: 127,236,433 S387G possibly damaging Het
Other mutations in Klk1b9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00934:Klk1b9 APN 7 43978454 missense probably damaging 1.00
IGL01330:Klk1b9 APN 7 43978443 nonsense probably null
IGL03329:Klk1b9 APN 7 43979414 missense probably benign 0.00
R0206:Klk1b9 UTSW 7 43979430 missense possibly damaging 0.70
R0208:Klk1b9 UTSW 7 43979430 missense possibly damaging 0.70
R0632:Klk1b9 UTSW 7 43979372 missense possibly damaging 0.56
R1289:Klk1b9 UTSW 7 43978424 missense probably benign
R1437:Klk1b9 UTSW 7 43979690 missense probably damaging 1.00
R1994:Klk1b9 UTSW 7 43979555 missense probably benign 0.04
R5006:Klk1b9 UTSW 7 43979287 nonsense probably null
R6572:Klk1b9 UTSW 7 43979735 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCAGATATGTGCATGTCTATCTGTC -3'
(R):5'- TGCTTGGACCAGACTCACAC -3'

Sequencing Primer
(F):5'- ATGTGCATGTCTATCTGTCTTCTTG -3'
(R):5'- CTCACACTTGAAAGGTGTAGTGC -3'
Posted On2019-05-15