Incidental Mutation 'R7149:Smarcc2'
ID554007
Institutional Source Beutler Lab
Gene Symbol Smarcc2
Ensembl Gene ENSMUSG00000025369
Gene NameSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2
Synonyms5930405J04Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.896) question?
Stock #R7149 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location128459248-128490482 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 128482729 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 627 (V627M)
Ref Sequence ENSEMBL: ENSMUSP00000100868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026433] [ENSMUST00000099131] [ENSMUST00000105235] [ENSMUST00000218228]
Predicted Effect probably damaging
Transcript: ENSMUST00000026433
AA Change: V627M

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000026433
Gene: ENSMUSG00000025369
AA Change: V627M

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
CHROMO 186 235 5.97e-6 SMART
low complexity region 297 307 N/A INTRINSIC
Pfam:SWIRM 424 512 4.9e-38 PFAM
low complexity region 545 557 N/A INTRINSIC
SANT 597 645 9.04e-12 SMART
low complexity region 768 816 N/A INTRINSIC
low complexity region 861 879 N/A INTRINSIC
coiled coil region 906 921 N/A INTRINSIC
low complexity region 948 982 N/A INTRINSIC
low complexity region 985 1010 N/A INTRINSIC
low complexity region 1012 1062 N/A INTRINSIC
low complexity region 1074 1098 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099131
AA Change: V658M

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000096734
Gene: ENSMUSG00000025369
AA Change: V658M

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
CHROMO 186 235 5.97e-6 SMART
low complexity region 297 307 N/A INTRINSIC
Pfam:SWIRM 424 512 3.9e-38 PFAM
SANT 628 676 9.04e-12 SMART
low complexity region 799 847 N/A INTRINSIC
low complexity region 892 910 N/A INTRINSIC
coiled coil region 937 952 N/A INTRINSIC
low complexity region 979 1013 N/A INTRINSIC
low complexity region 1016 1041 N/A INTRINSIC
low complexity region 1043 1093 N/A INTRINSIC
low complexity region 1105 1129 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105235
AA Change: V627M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100868
Gene: ENSMUSG00000025369
AA Change: V627M

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
CHROMO 186 235 5.97e-6 SMART
low complexity region 297 307 N/A INTRINSIC
Pfam:SWIRM 426 512 4.5e-35 PFAM
low complexity region 545 557 N/A INTRINSIC
SANT 597 645 9.04e-12 SMART
Pfam:SWIRM-assoc_3 684 750 4.1e-34 PFAM
low complexity region 768 816 N/A INTRINSIC
Pfam:SWIRM-assoc_1 863 946 1.5e-34 PFAM
low complexity region 948 982 N/A INTRINSIC
low complexity region 985 1010 N/A INTRINSIC
low complexity region 1012 1062 N/A INTRINSIC
low complexity region 1077 1093 N/A INTRINSIC
low complexity region 1108 1123 N/A INTRINSIC
low complexity region 1153 1177 N/A INTRINSIC
low complexity region 1184 1212 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218228
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins, whose members display helicase and ATPase activities and which are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI and contains a predicted leucine zipper motif typical of many transcription factors. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted allele exhibit a slight increase in embryo weight at E13.5 and die shortly after birth (P0-P3). Mice homozygous for a conditional allele activated in the brain exhibit reduced cerebral cortical size and thickness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik G A 1: 37,612,271 Q1172* probably null Het
Acly A C 11: 100,484,625 F790V probably damaging Het
Atf4 AAGCGGGCTGAGC AAGC 15: 80,257,299 probably benign Het
Brd8 C T 18: 34,604,597 probably null Het
Bsn A T 9: 108,116,321 L744* probably null Het
Capn9 A G 8: 124,605,709 D429G probably benign Het
CK137956 A T 4: 127,970,833 M1K probably null Het
Cnot6 G A 11: 49,680,143 P341S probably benign Het
Ddx58 T C 4: 40,222,079 D445G possibly damaging Het
Dld T G 12: 31,335,590 I251L probably benign Het
Dlg5 T C 14: 24,190,424 K253R probably benign Het
Dnmt3a C T 12: 3,902,397 P696L probably damaging Het
Dph1 T C 11: 75,179,175 K409E probably benign Het
Dsg2 T C 18: 20,579,454 S172P probably damaging Het
Gm1979 T C 5: 26,001,947 N136S probably benign Het
Gm2663 A T 6: 40,997,957 L60Q probably damaging Het
Gm5724 A G 6: 141,744,452 S192P probably damaging Het
Hdac10 A G 15: 89,127,449 F144S probably damaging Het
Ifi203 T C 1: 173,928,928 T430A unknown Het
Itgb2l T C 16: 96,433,559 D244G probably damaging Het
Klk1b9 A T 7: 43,979,417 Y115F probably benign Het
Llcfc1 C A 6: 41,685,317 A85E possibly damaging Het
Lrp1b C T 2: 40,637,860 V4330M Het
Map3k13 A G 16: 21,925,437 E811G probably benign Het
Myl6b A G 10: 128,497,199 probably null Het
Myo15 G A 11: 60,510,010 A2997T possibly damaging Het
Nalcn T C 14: 123,599,865 D29G probably benign Het
Nepro T A 16: 44,729,715 probably null Het
Nlrp1b T A 11: 71,181,656 R454* probably null Het
Nlrp4a T C 7: 26,450,438 V490A probably benign Het
Olfr166 T C 16: 19,487,510 V224A probably damaging Het
Olfr397 G A 11: 73,965,431 M274I probably benign Het
Pde8b T G 13: 95,086,841 M197L probably benign Het
Phldb2 T A 16: 45,751,532 K1166* probably null Het
Plekhm1 A G 11: 103,394,916 I231T probably damaging Het
Ppp6r2 T C 15: 89,262,396 I199T probably damaging Het
Ptch1 G T 13: 63,511,736 H1368N probably benign Het
Ptprj T A 2: 90,444,446 T1191S possibly damaging Het
Rapgef1 T C 2: 29,720,700 S748P probably damaging Het
Rnmt T C 18: 68,319,151 S420P probably damaging Het
Sgms2 A G 3: 131,336,259 F160S possibly damaging Het
Sim1 G T 10: 50,909,540 R235L probably damaging Het
Smarcad1 T A 6: 65,052,732 D101E probably benign Het
Supt20 G A 3: 54,728,411 R241H unknown Het
Tagln2 T A 1: 172,505,819 I80N probably damaging Het
Tmod2 G A 9: 75,581,885 T226I possibly damaging Het
Vmn2r80 A T 10: 79,194,820 I827F probably benign Het
Vmn2r96 T A 17: 18,597,727 M714K possibly damaging Het
Vps8 C A 16: 21,459,776 D261E probably damaging Het
Yeats2 C A 16: 20,154,189 A31E probably damaging Het
Zfp451 C T 1: 33,777,324 R515Q probably damaging Het
Zfp553 A G 7: 127,236,433 S387G possibly damaging Het
Other mutations in Smarcc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Smarcc2 APN 10 128463055 missense probably damaging 0.97
IGL01450:Smarcc2 APN 10 128469320 missense probably damaging 1.00
IGL01638:Smarcc2 APN 10 128488074 unclassified probably benign
IGL01663:Smarcc2 APN 10 128488977 unclassified probably benign
IGL02308:Smarcc2 APN 10 128482772 missense probably damaging 1.00
IGL02511:Smarcc2 APN 10 128461382 missense probably damaging 1.00
IGL02633:Smarcc2 APN 10 128469687 missense probably damaging 1.00
IGL03375:Smarcc2 APN 10 128482912 missense probably damaging 0.99
IGL03493:Smarcc2 APN 10 128461357 missense probably damaging 1.00
PIT4403001:Smarcc2 UTSW 10 128463024 missense probably damaging 1.00
R0220:Smarcc2 UTSW 10 128483636 missense probably benign 0.32
R0281:Smarcc2 UTSW 10 128474722 missense probably benign 0.20
R1299:Smarcc2 UTSW 10 128461378 missense probably damaging 1.00
R1447:Smarcc2 UTSW 10 128469791 critical splice donor site probably null
R1466:Smarcc2 UTSW 10 128474245 missense probably damaging 0.98
R1466:Smarcc2 UTSW 10 128474245 missense probably damaging 0.98
R1498:Smarcc2 UTSW 10 128482192 missense probably benign 0.02
R1499:Smarcc2 UTSW 10 128463872 missense probably damaging 0.99
R1616:Smarcc2 UTSW 10 128482793 missense probably damaging 1.00
R1718:Smarcc2 UTSW 10 128468998 intron probably benign
R1767:Smarcc2 UTSW 10 128469082 missense possibly damaging 0.92
R1792:Smarcc2 UTSW 10 128463871 missense probably damaging 1.00
R1965:Smarcc2 UTSW 10 128474758 missense probably damaging 1.00
R2229:Smarcc2 UTSW 10 128488341 unclassified probably benign
R2286:Smarcc2 UTSW 10 128463743 missense possibly damaging 0.58
R2367:Smarcc2 UTSW 10 128482167 missense possibly damaging 0.86
R2398:Smarcc2 UTSW 10 128469682 missense possibly damaging 0.92
R3084:Smarcc2 UTSW 10 128488159 unclassified probably benign
R3085:Smarcc2 UTSW 10 128488159 unclassified probably benign
R3777:Smarcc2 UTSW 10 128482943 critical splice donor site probably null
R4346:Smarcc2 UTSW 10 128468823 missense probably benign 0.02
R4967:Smarcc2 UTSW 10 128483180 missense probably damaging 0.99
R4992:Smarcc2 UTSW 10 128474710 missense probably damaging 0.99
R5028:Smarcc2 UTSW 10 128461445 missense probably damaging 0.99
R5071:Smarcc2 UTSW 10 128463940 missense probably damaging 1.00
R5095:Smarcc2 UTSW 10 128469300 missense probably damaging 0.99
R5133:Smarcc2 UTSW 10 128461473 critical splice donor site probably null
R5180:Smarcc2 UTSW 10 128487362 unclassified probably benign
R5231:Smarcc2 UTSW 10 128461352 missense probably damaging 1.00
R5240:Smarcc2 UTSW 10 128481006 critical splice donor site probably null
R5401:Smarcc2 UTSW 10 128465504 missense probably damaging 1.00
R5445:Smarcc2 UTSW 10 128488074 unclassified probably benign
R5690:Smarcc2 UTSW 10 128484407 missense probably damaging 1.00
R5694:Smarcc2 UTSW 10 128484127 missense probably benign
R6240:Smarcc2 UTSW 10 128488024 unclassified probably benign
R6545:Smarcc2 UTSW 10 128484128 missense probably benign 0.00
R6713:Smarcc2 UTSW 10 128487769 intron probably null
R6934:Smarcc2 UTSW 10 128469672 missense probably benign 0.27
R7016:Smarcc2 UTSW 10 128485329 intron probably null
R7229:Smarcc2 UTSW 10 128488048 missense unknown
R7395:Smarcc2 UTSW 10 128485606 missense probably damaging 1.00
Z1088:Smarcc2 UTSW 10 128461434 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGATCCAGCAGAGTACAG -3'
(R):5'- CCCCAAATTACCTAGGGCTG -3'

Sequencing Primer
(F):5'- CTGGATCCAGCAGAGTACAGAAAAC -3'
(R):5'- AATTACCTAGGGCTGACTTCGCAG -3'
Posted On2019-05-15