Incidental Mutation 'R7150:Lrp2'
ID554040
Institutional Source Beutler Lab
Gene Symbol Lrp2
Ensembl Gene ENSMUSG00000027070
Gene Namelow density lipoprotein receptor-related protein 2
SynonymsGp330, D230004K18Rik, b2b1625.2Clo, Megalin
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7150 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location69424340-69586065 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69488051 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 2019 (S2019P)
Ref Sequence ENSEMBL: ENSMUSP00000079752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080953]
Predicted Effect probably damaging
Transcript: ENSMUST00000080953
AA Change: S2019P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000079752
Gene: ENSMUSG00000027070
AA Change: S2019P

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
LDLa 27 64 5.63e-13 SMART
LDLa 66 105 2.25e-12 SMART
EGF 107 143 2.59e1 SMART
LDLa 107 144 9.29e-14 SMART
LDLa 146 181 6.18e-10 SMART
LDLa 182 219 1.08e-14 SMART
LDLa 221 258 1.05e-12 SMART
LDLa 264 302 1.66e-10 SMART
EGF 310 346 3.23e0 SMART
EGF 350 385 2.32e-1 SMART
LY 414 457 3.88e-3 SMART
LY 458 500 1.17e-6 SMART
LY 501 547 5.96e-13 SMART
LY 548 590 1.94e-12 SMART
LY 591 634 2.66e0 SMART
EGF 661 704 7.76e-3 SMART
LY 732 774 1.76e0 SMART
LY 775 817 3.64e-8 SMART
LY 818 860 1.11e-3 SMART
LY 861 903 2.11e-13 SMART
LY 905 946 9.33e-1 SMART
EGF 972 1013 1.73e0 SMART
LDLa 1024 1061 1.05e-12 SMART
LDLa 1065 1103 4.65e-14 SMART
LDLa 1109 1146 3.63e-16 SMART
LDLa 1149 1186 5.5e-16 SMART
LDLa 1187 1225 1.43e-14 SMART
LDLa 1230 1269 2.1e-12 SMART
LDLa 1271 1308 3.63e-16 SMART
LDLa 1312 1351 4.69e-10 SMART
EGF 1353 1390 9.7e-4 SMART
EGF_CA 1391 1430 6.54e-10 SMART
LY 1457 1501 1.43e-1 SMART
LY 1502 1544 2e-14 SMART
LY 1545 1590 3.03e-14 SMART
LY 1591 1633 5.48e-12 SMART
LY 1635 1677 1.18e-2 SMART
EGF 1704 1742 5.2e-4 SMART
LY 1771 1812 1.68e1 SMART
LY 1813 1856 1.91e-2 SMART
LY 1859 1911 1.88e-10 SMART
LY 1912 1954 7.69e-7 SMART
LY 1955 1994 3e1 SMART
EGF 2022 2060 1.18e-2 SMART
LY 2088 2135 1.14e1 SMART
LY 2136 2182 2.11e-4 SMART
LY 2183 2226 2.22e-12 SMART
LY 2227 2269 1.24e-10 SMART
EGF 2346 2384 2.07e1 SMART
LY 2459 2501 9.91e-10 SMART
LY 2503 2543 1.48e-8 SMART
LY 2544 2586 6.85e-13 SMART
LY 2587 2627 8.13e-1 SMART
EGF_like 2655 2694 3.5e1 SMART
LDLa 2700 2739 2.86e-14 SMART
LDLa 2741 2778 8.09e-14 SMART
LDLa 2780 2820 3.19e-12 SMART
LDLa 2822 2862 6.94e-13 SMART
LDLa 2864 2903 9.29e-14 SMART
LDLa 2907 2947 4.79e-16 SMART
LDLa 2949 2992 8.41e-12 SMART
LDLa 2994 3031 1.08e-14 SMART
LDLa 3033 3072 1.83e-12 SMART
LDLa 3076 3113 1.16e-14 SMART
EGF 3115 3153 8.57e-5 SMART
EGF_CA 3154 3194 3.56e-11 SMART
LY 3221 3263 9.77e-9 SMART
LY 3264 3306 1.22e-9 SMART
LY 3312 3358 5.44e-7 SMART
LY 3359 3401 1.83e-13 SMART
LY 3402 3443 1.41e-5 SMART
EGF 3470 3511 8.91e-3 SMART
LDLa 3513 3552 1.79e-15 SMART
LDLa 3554 3593 9.89e-9 SMART
LDLa 3595 3634 3.07e-14 SMART
LDLa 3636 3675 3.34e-15 SMART
LDLa 3679 3718 1.39e-12 SMART
LDLa 3720 3758 3.83e-15 SMART
LDLa 3760 3797 7.15e-15 SMART
LDLa 3799 3836 2.86e-14 SMART
LDLa 3843 3882 2.38e-11 SMART
LDLa 3884 3924 3.66e-12 SMART
LDLa 3929 3966 1.93e-11 SMART
EGF 3971 4008 6.3e-3 SMART
EGF_CA 4009 4050 1.36e-7 SMART
low complexity region 4072 4084 N/A INTRINSIC
LY 4136 4178 6.2e-11 SMART
LY 4179 4222 4.32e-10 SMART
LY 4223 4266 3.78e-15 SMART
LY 4267 4306 4.53e1 SMART
EGF 4335 4367 3.46e0 SMART
EGF 4368 4413 1.53e-1 SMART
transmembrane domain 4425 4447 N/A INTRINSIC
low complexity region 4454 4472 N/A INTRINSIC
low complexity region 4616 4636 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, low density lipoprotein-related protein 2 (LRP2) or megalin, is a multi-ligand endocytic receptor that is expressed in many different tissues but primarily in absorptive epithilial tissues such as the kidney. This glycoprotein has a large amino-terminal extracellular domain, a single transmembrane domain, and a short carboxy-terminal cytoplasmic tail. The extracellular ligand-binding-domains bind diverse macromolecules including albumin, apolipoproteins B and E, and lipoprotein lipase. The LRP2 protein is critical for the reuptake of numerous ligands, including lipoproteins, sterols, vitamin-binding proteins, and hormones. This protein also has a role in cell-signaling; extracellular ligands include parathyroid horomones and the morphogen sonic hedgehog while cytosolic ligands include MAP kinase scaffold proteins and JNK interacting proteins. Recycling of this membrane receptor is regulated by phosphorylation of its cytoplasmic domain. Mutations in this gene cause Donnai-Barrow syndrome (DBS) and facio-oculoacoustico-renal syndrome (FOAR).[provided by RefSeq, Aug 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit lung and kidney epithelial defects, impaired B12 uptake, reduced proliferation of the neuroepithelium resulting in lack of olfactory bulbs, forebrain fusions, ventricular defects, and perinatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik T C 8: 124,862,914 D20G possibly damaging Het
5430401F13Rik T C 6: 131,552,667 S75P probably benign Het
9530003J23Rik T C 10: 117,237,742 N62S probably benign Het
Acad8 A T 9: 26,978,454 F315I probably damaging Het
Adcy5 A G 16: 35,298,534 Y1085C probably damaging Het
Aldh1a7 T C 19: 20,716,018 K179R probably damaging Het
Arhgap10 C T 8: 77,250,954 G776R probably damaging Het
Arhgap35 A C 7: 16,562,566 F858C probably damaging Het
Ash1l C T 3: 89,077,074 R2957W probably damaging Het
Atp6ap1l G T 13: 90,883,729 A278E probably damaging Het
Btn1a1 A T 13: 23,459,351 D309E probably damaging Het
Casd1 C T 6: 4,624,211 R335C probably benign Het
Ceacam3 A G 7: 17,151,562 Q30R Het
Cfap20 C T 8: 95,422,167 C119Y probably damaging Het
Cntrl A T 2: 35,165,445 probably null Het
Crot A G 5: 8,987,878 V146A probably damaging Het
Cx3cl1 A G 8: 94,779,963 S199G probably damaging Het
D5Ertd577e A G 5: 95,482,821 I186V possibly damaging Het
Ddhd1 A T 14: 45,657,806 L69Q probably damaging Het
Dnah12 T C 14: 26,861,732 F3195L probably damaging Het
Dpy19l3 A T 7: 35,708,630 D450E probably benign Het
Ercc3 A T 18: 32,257,272 N538I probably damaging Het
Fzd1 A T 5: 4,756,145 V479E probably benign Het
Gart T C 16: 91,628,463 Y638C possibly damaging Het
Gm2381 C A 7: 42,820,464 V79L probably benign Het
Gucy1b1 T C 3: 82,043,162 Y312C probably damaging Het
Hecw1 T A 13: 14,434,460 M1L probably benign Het
Ip6k2 A G 9: 108,796,731 I99V unknown Het
Itgb5 C T 16: 33,940,643 T616I probably benign Het
Kmt2c A C 5: 25,300,362 V3316G possibly damaging Het
Lama3 C T 18: 12,468,289 R1008C probably damaging Het
Lin54 T C 5: 100,485,300 D175G possibly damaging Het
Lrrc9 A G 12: 72,466,952 E528G probably benign Het
Mto1 A G 9: 78,457,283 H299R probably damaging Het
Myo19 G A 11: 84,905,613 G684R probably benign Het
Olfr297 A C 7: 86,527,114 D119A probably damaging Het
Olfr851 A T 9: 19,496,849 M34L probably benign Het
Pcdh18 C A 3: 49,754,694 C724F probably benign Het
Pcdha3 A T 18: 36,947,112 K302N probably benign Het
Pcdhgb2 T C 18: 37,692,247 F764L possibly damaging Het
Pik3cb C A 9: 99,093,090 G246W probably damaging Het
Polr2m A T 9: 71,483,344 I192N probably damaging Het
Polr2m G T 9: 71,483,533 T129K probably benign Het
Ptpn4 C T 1: 119,691,745 probably null Het
Scgb1b19 A T 7: 33,287,515 K30N possibly damaging Het
Shpk A G 11: 73,213,489 T155A probably damaging Het
Slit3 T C 11: 35,570,719 Y261H probably damaging Het
Sox13 A G 1: 133,385,505 F438L possibly damaging Het
Sphk1 A T 11: 116,535,081 E61D probably benign Het
St18 A G 1: 6,803,019 D326G probably damaging Het
Syde1 G A 10: 78,586,198 Q566* probably null Het
Tacc2 A G 7: 130,729,077 T254A probably benign Het
Tbc1d1 A G 5: 64,173,484 E2G probably damaging Het
Trim5 A T 7: 104,276,810 N181K probably damaging Het
Trpc7 A T 13: 56,783,696 I730K probably benign Het
Uqcrc1 T A 9: 108,947,858 M377K probably benign Het
Vmn2r4 T C 3: 64,398,477 N508S probably benign Het
Vmp1 A T 11: 86,586,576 S333T probably benign Het
Vps50 T A 6: 3,578,854 M639K possibly damaging Het
Zfp874b A T 13: 67,474,503 C225* probably null Het
Other mutations in Lrp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Lrp2 APN 2 69507779 missense probably damaging 1.00
IGL00594:Lrp2 APN 2 69486280 missense probably benign 0.00
IGL00782:Lrp2 APN 2 69501645 missense probably benign 0.14
IGL00821:Lrp2 APN 2 69459516 missense probably damaging 1.00
IGL00897:Lrp2 APN 2 69521881 missense possibly damaging 0.86
IGL01065:Lrp2 APN 2 69469436 missense possibly damaging 0.94
IGL01087:Lrp2 APN 2 69524073 missense probably damaging 1.00
IGL01095:Lrp2 APN 2 69492432 nonsense probably null
IGL01131:Lrp2 APN 2 69499239 missense probably damaging 1.00
IGL01350:Lrp2 APN 2 69510984 missense probably damaging 0.96
IGL01352:Lrp2 APN 2 69503526 missense possibly damaging 0.77
IGL01358:Lrp2 APN 2 69552470 splice site probably benign
IGL01375:Lrp2 APN 2 69478566 splice site probably benign
IGL01384:Lrp2 APN 2 69483502 missense probably damaging 1.00
IGL01384:Lrp2 APN 2 69453812 missense probably null 1.00
IGL01411:Lrp2 APN 2 69482267 missense probably damaging 1.00
IGL01418:Lrp2 APN 2 69525286 missense probably benign
IGL01444:Lrp2 APN 2 69443716 missense possibly damaging 0.94
IGL01464:Lrp2 APN 2 69472439 missense probably damaging 0.98
IGL01528:Lrp2 APN 2 69492460 missense probably damaging 1.00
IGL01663:Lrp2 APN 2 69428706 missense probably benign
IGL01761:Lrp2 APN 2 69481235 missense possibly damaging 0.85
IGL01780:Lrp2 APN 2 69486184 missense possibly damaging 0.66
IGL01994:Lrp2 APN 2 69483601 missense probably benign 0.08
IGL02015:Lrp2 APN 2 69527578 missense probably benign 0.00
IGL02104:Lrp2 APN 2 69510418 missense probably damaging 1.00
IGL02132:Lrp2 APN 2 69537616 missense probably benign 0.01
IGL02134:Lrp2 APN 2 69513379 critical splice acceptor site probably null
IGL02197:Lrp2 APN 2 69466880 missense probably benign 0.01
IGL02212:Lrp2 APN 2 69451264 missense probably benign 0.00
IGL02240:Lrp2 APN 2 69535046 missense probably benign
IGL02248:Lrp2 APN 2 69482808 missense probably damaging 1.00
IGL02369:Lrp2 APN 2 69464636 missense probably damaging 1.00
IGL02416:Lrp2 APN 2 69469633 missense probably damaging 1.00
IGL02417:Lrp2 APN 2 69461305 missense probably damaging 1.00
IGL02458:Lrp2 APN 2 69521773 missense probably damaging 0.97
IGL02479:Lrp2 APN 2 69464801 splice site probably benign
IGL02508:Lrp2 APN 2 69503430 missense probably benign 0.04
IGL02751:Lrp2 APN 2 69533462 missense possibly damaging 0.56
IGL02814:Lrp2 APN 2 69506736 missense probably damaging 1.00
IGL02867:Lrp2 APN 2 69552450 missense possibly damaging 0.67
IGL02889:Lrp2 APN 2 69552450 missense possibly damaging 0.67
IGL02943:Lrp2 APN 2 69455510 missense possibly damaging 0.86
IGL02948:Lrp2 APN 2 69487837 missense probably damaging 1.00
IGL02960:Lrp2 APN 2 69455453 splice site probably benign
IGL02990:Lrp2 APN 2 69441396 missense possibly damaging 0.56
IGL03027:Lrp2 APN 2 69537553 missense probably benign 0.43
IGL03038:Lrp2 APN 2 69475464 missense probably damaging 0.99
IGL03064:Lrp2 APN 2 69483133 missense probably damaging 0.98
IGL03107:Lrp2 APN 2 69454833 missense probably damaging 1.00
IGL03141:Lrp2 APN 2 69477026 missense probably damaging 0.99
IGL03154:Lrp2 APN 2 69549042 missense probably damaging 1.00
IGL03155:Lrp2 APN 2 69455452 splice site probably benign
IGL03163:Lrp2 APN 2 69501526 nonsense probably null
IGL03164:Lrp2 APN 2 69464699 missense probably damaging 1.00
IGL03169:Lrp2 APN 2 69523194 missense probably damaging 1.00
IGL03174:Lrp2 APN 2 69466265 missense probably damaging 1.00
IGL03189:Lrp2 APN 2 69438478 splice site probably benign
IGL03288:Lrp2 APN 2 69426039 missense probably benign 0.02
IGL03350:Lrp2 APN 2 69438453 missense probably damaging 1.00
IGL03378:Lrp2 APN 2 69431152 missense probably damaging 1.00
casual UTSW 2 69499263 missense probably benign
relaxed UTSW 2 69535005 missense probably damaging 1.00
unintended UTSW 2 69518443 missense probably damaging 1.00
IGL02835:Lrp2 UTSW 2 69505304 missense probably damaging 1.00
IGL03055:Lrp2 UTSW 2 69458448 missense probably damaging 1.00
PIT4362001:Lrp2 UTSW 2 69537538 missense probably damaging 1.00
PIT4504001:Lrp2 UTSW 2 69475403 missense probably damaging 1.00
R0008:Lrp2 UTSW 2 69516551 missense probably benign 0.42
R0008:Lrp2 UTSW 2 69516551 missense probably benign 0.42
R0044:Lrp2 UTSW 2 69527555 missense probably damaging 0.96
R0044:Lrp2 UTSW 2 69527555 missense probably benign 0.01
R0048:Lrp2 UTSW 2 69465627 missense probably damaging 1.00
R0098:Lrp2 UTSW 2 69475412 missense probably damaging 1.00
R0098:Lrp2 UTSW 2 69475412 missense probably damaging 1.00
R0103:Lrp2 UTSW 2 69477040 missense probably benign
R0167:Lrp2 UTSW 2 69425658 missense possibly damaging 0.95
R0226:Lrp2 UTSW 2 69537563 missense probably null 1.00
R0243:Lrp2 UTSW 2 69428630 missense probably benign 0.00
R0308:Lrp2 UTSW 2 69482982 splice site probably benign
R0323:Lrp2 UTSW 2 69469639 missense probably damaging 1.00
R0372:Lrp2 UTSW 2 69535043 missense probably benign 0.10
R0374:Lrp2 UTSW 2 69430307 missense probably damaging 1.00
R0391:Lrp2 UTSW 2 69456858 missense probably damaging 0.99
R0391:Lrp2 UTSW 2 69460337 splice site probably benign
R0395:Lrp2 UTSW 2 69433077 missense possibly damaging 0.89
R0401:Lrp2 UTSW 2 69479148 missense probably damaging 0.98
R0471:Lrp2 UTSW 2 69525234 missense probably damaging 0.97
R0483:Lrp2 UTSW 2 69507801 missense probably damaging 0.99
R0502:Lrp2 UTSW 2 69511017 missense probably damaging 1.00
R0542:Lrp2 UTSW 2 69428654 missense probably benign 0.00
R0544:Lrp2 UTSW 2 69491931 missense probably benign 0.18
R0548:Lrp2 UTSW 2 69537638 splice site probably benign
R0593:Lrp2 UTSW 2 69467006 missense probably benign
R0608:Lrp2 UTSW 2 69486243 missense probably benign 0.02
R0633:Lrp2 UTSW 2 69448120 missense probably damaging 1.00
R0691:Lrp2 UTSW 2 69451380 missense probably benign 0.19
R0718:Lrp2 UTSW 2 69510948 missense probably damaging 1.00
R0737:Lrp2 UTSW 2 69448169 missense probably damaging 0.96
R0771:Lrp2 UTSW 2 69507990 missense probably damaging 1.00
R0784:Lrp2 UTSW 2 69518365 missense probably benign 0.32
R0885:Lrp2 UTSW 2 69482353 missense possibly damaging 0.75
R0947:Lrp2 UTSW 2 69487838 missense probably damaging 1.00
R1235:Lrp2 UTSW 2 69524036 missense probably damaging 1.00
R1293:Lrp2 UTSW 2 69523302 unclassified probably null
R1301:Lrp2 UTSW 2 69428604 missense probably damaging 0.98
R1387:Lrp2 UTSW 2 69456918 missense probably damaging 1.00
R1459:Lrp2 UTSW 2 69460477 missense probably damaging 1.00
R1459:Lrp2 UTSW 2 69483394 missense probably damaging 0.99
R1529:Lrp2 UTSW 2 69523182 missense probably damaging 1.00
R1543:Lrp2 UTSW 2 69500730 missense probably damaging 1.00
R1546:Lrp2 UTSW 2 69502610 missense probably damaging 1.00
R1550:Lrp2 UTSW 2 69502661 missense possibly damaging 0.74
R1590:Lrp2 UTSW 2 69466763 critical splice donor site probably null
R1689:Lrp2 UTSW 2 69503529 missense probably benign 0.09
R1693:Lrp2 UTSW 2 69510418 missense probably damaging 1.00
R1753:Lrp2 UTSW 2 69496489 missense possibly damaging 0.87
R1799:Lrp2 UTSW 2 69503530 missense probably benign 0.04
R1834:Lrp2 UTSW 2 69466880 missense probably benign 0.01
R1921:Lrp2 UTSW 2 69523287 missense probably damaging 1.00
R2000:Lrp2 UTSW 2 69467090 missense probably damaging 1.00
R2077:Lrp2 UTSW 2 69507843 missense probably damaging 1.00
R2092:Lrp2 UTSW 2 69536021 missense probably benign 0.25
R2093:Lrp2 UTSW 2 69536021 missense probably benign 0.25
R2108:Lrp2 UTSW 2 69506624 missense possibly damaging 0.75
R2117:Lrp2 UTSW 2 69483385 missense probably benign 0.05
R2122:Lrp2 UTSW 2 69483707 missense probably damaging 1.00
R2134:Lrp2 UTSW 2 69511067 missense probably damaging 1.00
R2207:Lrp2 UTSW 2 69467028 missense possibly damaging 0.94
R2248:Lrp2 UTSW 2 69511010 missense probably damaging 1.00
R2264:Lrp2 UTSW 2 69482366 missense possibly damaging 0.88
R2316:Lrp2 UTSW 2 69491847 missense possibly damaging 0.75
R2513:Lrp2 UTSW 2 69506374 splice site probably null
R2984:Lrp2 UTSW 2 69425814 splice site probably null
R3085:Lrp2 UTSW 2 69467135 missense probably benign 0.05
R3103:Lrp2 UTSW 2 69431984 missense probably benign 0.00
R3727:Lrp2 UTSW 2 69510429 missense probably damaging 1.00
R3730:Lrp2 UTSW 2 69464579 missense probably damaging 0.99
R3730:Lrp2 UTSW 2 69534907 critical splice donor site probably null
R3731:Lrp2 UTSW 2 69464579 missense probably damaging 0.99
R3731:Lrp2 UTSW 2 69534907 critical splice donor site probably null
R3764:Lrp2 UTSW 2 69496336 missense probably damaging 1.00
R3768:Lrp2 UTSW 2 69505105 missense probably benign 0.34
R3778:Lrp2 UTSW 2 69509204 missense probably benign 0.00
R3808:Lrp2 UTSW 2 69501548 missense probably damaging 1.00
R3809:Lrp2 UTSW 2 69501548 missense probably damaging 1.00
R3813:Lrp2 UTSW 2 69464579 missense probably damaging 0.99
R3828:Lrp2 UTSW 2 69426012 missense probably benign 0.03
R3852:Lrp2 UTSW 2 69537565 missense probably damaging 0.96
R3877:Lrp2 UTSW 2 69459472 critical splice donor site probably null
R3877:Lrp2 UTSW 2 69549047 missense probably damaging 1.00
R3922:Lrp2 UTSW 2 69506376 missense probably benign
R4081:Lrp2 UTSW 2 69513273 missense probably damaging 0.98
R4082:Lrp2 UTSW 2 69513273 missense probably damaging 0.98
R4118:Lrp2 UTSW 2 69430262 critical splice donor site probably null
R4193:Lrp2 UTSW 2 69467143 missense probably damaging 1.00
R4284:Lrp2 UTSW 2 69480094 missense possibly damaging 0.95
R4322:Lrp2 UTSW 2 69425991 nonsense probably null
R4352:Lrp2 UTSW 2 69432182 critical splice donor site probably null
R4407:Lrp2 UTSW 2 69502517 missense probably damaging 1.00
R4408:Lrp2 UTSW 2 69467169 missense probably benign 0.09
R4416:Lrp2 UTSW 2 69527231 missense probably benign 0.18
R4426:Lrp2 UTSW 2 69506348 missense probably benign 0.00
R4510:Lrp2 UTSW 2 69480062 missense possibly damaging 0.58
R4511:Lrp2 UTSW 2 69480062 missense possibly damaging 0.58
R4553:Lrp2 UTSW 2 69513285 missense probably benign 0.13
R4591:Lrp2 UTSW 2 69536075 missense probably damaging 1.00
R4612:Lrp2 UTSW 2 69458427 nonsense probably null
R4622:Lrp2 UTSW 2 69460349 missense possibly damaging 0.87
R4632:Lrp2 UTSW 2 69489129 splice site probably null
R4633:Lrp2 UTSW 2 69461417 missense probably benign 0.16
R4636:Lrp2 UTSW 2 69436639 missense possibly damaging 0.93
R4657:Lrp2 UTSW 2 69466993 missense probably damaging 1.00
R4667:Lrp2 UTSW 2 69489298 missense probably benign 0.02
R4712:Lrp2 UTSW 2 69506551 missense probably damaging 1.00
R4713:Lrp2 UTSW 2 69487966 missense probably damaging 1.00
R4720:Lrp2 UTSW 2 69481173 missense probably damaging 0.99
R4732:Lrp2 UTSW 2 69533555 missense probably benign
R4733:Lrp2 UTSW 2 69533555 missense probably benign
R4777:Lrp2 UTSW 2 69482264 missense probably damaging 1.00
R4779:Lrp2 UTSW 2 69459715 missense possibly damaging 0.75
R4786:Lrp2 UTSW 2 69537956 missense probably damaging 1.00
R4842:Lrp2 UTSW 2 69469411 missense probably benign 0.06
R4845:Lrp2 UTSW 2 69509241 missense possibly damaging 0.71
R4846:Lrp2 UTSW 2 69479113 missense probably damaging 1.00
R4938:Lrp2 UTSW 2 69472368 missense probably damaging 0.98
R4951:Lrp2 UTSW 2 69535988 missense probably damaging 1.00
R4990:Lrp2 UTSW 2 69481388 missense probably benign 0.01
R5075:Lrp2 UTSW 2 69465758 missense probably benign 0.00
R5078:Lrp2 UTSW 2 69501530 missense possibly damaging 0.93
R5102:Lrp2 UTSW 2 69489158 missense probably damaging 0.98
R5124:Lrp2 UTSW 2 69501490 missense probably damaging 0.97
R5131:Lrp2 UTSW 2 69430342 missense possibly damaging 0.74
R5141:Lrp2 UTSW 2 69552349 splice site probably null
R5223:Lrp2 UTSW 2 69524053 missense probably damaging 0.99
R5236:Lrp2 UTSW 2 69456819 splice site probably null
R5267:Lrp2 UTSW 2 69548978 missense possibly damaging 0.83
R5290:Lrp2 UTSW 2 69513354 missense probably damaging 1.00
R5333:Lrp2 UTSW 2 69525228 missense probably benign 0.01
R5355:Lrp2 UTSW 2 69454838 nonsense probably null
R5356:Lrp2 UTSW 2 69464708 missense possibly damaging 0.74
R5369:Lrp2 UTSW 2 69459560 missense probably benign 0.04
R5486:Lrp2 UTSW 2 69437465 missense probably benign 0.04
R5554:Lrp2 UTSW 2 69552424 missense possibly damaging 0.92
R5584:Lrp2 UTSW 2 69451288 missense probably damaging 1.00
R5585:Lrp2 UTSW 2 69464624 missense possibly damaging 0.77
R5587:Lrp2 UTSW 2 69499263 missense probably benign
R5605:Lrp2 UTSW 2 69523299 missense probably damaging 1.00
R5637:Lrp2 UTSW 2 69472418 missense probably damaging 1.00
R5647:Lrp2 UTSW 2 69519914 missense probably null 0.80
R5686:Lrp2 UTSW 2 69511061 missense possibly damaging 0.88
R5691:Lrp2 UTSW 2 69502553 missense probably damaging 1.00
R5724:Lrp2 UTSW 2 69451382 missense probably damaging 0.99
R5726:Lrp2 UTSW 2 69509147 missense probably damaging 1.00
R5743:Lrp2 UTSW 2 69466877 missense probably damaging 1.00
R5777:Lrp2 UTSW 2 69455525 missense probably damaging 1.00
R5841:Lrp2 UTSW 2 69480153 missense probably benign 0.00
R5892:Lrp2 UTSW 2 69442776 missense probably benign
R5951:Lrp2 UTSW 2 69496323 splice site probably null
R5974:Lrp2 UTSW 2 69459548 missense probably damaging 1.00
R5980:Lrp2 UTSW 2 69535005 missense probably damaging 1.00
R6046:Lrp2 UTSW 2 69506754 missense probably damaging 1.00
R6113:Lrp2 UTSW 2 69483557 missense possibly damaging 0.76
R6146:Lrp2 UTSW 2 69511001 missense probably benign 0.00
R6177:Lrp2 UTSW 2 69510419 frame shift probably null
R6180:Lrp2 UTSW 2 69503524 missense possibly damaging 0.85
R6219:Lrp2 UTSW 2 69469478 missense probably damaging 1.00
R6228:Lrp2 UTSW 2 69482366 missense possibly damaging 0.88
R6265:Lrp2 UTSW 2 69466340 missense probably damaging 1.00
R6312:Lrp2 UTSW 2 69436681 missense probably damaging 1.00
R6337:Lrp2 UTSW 2 69438467 missense probably damaging 1.00
R6376:Lrp2 UTSW 2 69483443 missense probably benign 0.02
R6385:Lrp2 UTSW 2 69495784 missense probably benign 0.22
R6429:Lrp2 UTSW 2 69461287 missense probably damaging 1.00
R6458:Lrp2 UTSW 2 69505156 missense probably benign 0.00
R6524:Lrp2 UTSW 2 69436639 missense possibly damaging 0.93
R6555:Lrp2 UTSW 2 69509303 missense probably benign 0.00
R6594:Lrp2 UTSW 2 69439923 missense possibly damaging 0.58
R6599:Lrp2 UTSW 2 69469405 missense probably damaging 1.00
R6655:Lrp2 UTSW 2 69453858 missense probably benign 0.01
R6718:Lrp2 UTSW 2 69483780 missense probably benign 0.09
R6736:Lrp2 UTSW 2 69448211 missense probably benign 0.02
R6738:Lrp2 UTSW 2 69458488 missense probably damaging 0.97
R6799:Lrp2 UTSW 2 69483904 missense probably damaging 1.00
R6846:Lrp2 UTSW 2 69518443 missense probably damaging 1.00
R6856:Lrp2 UTSW 2 69513268 missense probably damaging 1.00
R6861:Lrp2 UTSW 2 69513377 missense possibly damaging 0.77
R6888:Lrp2 UTSW 2 69524141 missense probably damaging 0.98
R6897:Lrp2 UTSW 2 69510502 missense probably benign
R6902:Lrp2 UTSW 2 69459503 missense probably damaging 1.00
R6908:Lrp2 UTSW 2 69472365 missense probably damaging 1.00
R6918:Lrp2 UTSW 2 69489305 missense probably damaging 1.00
R6989:Lrp2 UTSW 2 69472455 missense probably damaging 1.00
R7022:Lrp2 UTSW 2 69483208 missense probably damaging 1.00
R7025:Lrp2 UTSW 2 69483028 missense possibly damaging 0.90
R7026:Lrp2 UTSW 2 69521787 missense probably damaging 0.97
R7138:Lrp2 UTSW 2 69465745 missense possibly damaging 0.94
R7145:Lrp2 UTSW 2 69454808 critical splice donor site probably null
X0011:Lrp2 UTSW 2 69519998 missense probably damaging 1.00
X0023:Lrp2 UTSW 2 69436600 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAAAGCCTCTAACTGCAGGC -3'
(R):5'- ACAACACTGCTCCATCTTCTAACTG -3'

Sequencing Primer
(F):5'- GCAGCATGGAAACGACTATG -3'
(R):5'- CATCTTCTAACTGCCATACACTG -3'
Posted On2019-05-15