Mutagenetix > Incidental Mutation

Incidental Mutation 'R7152:Nphp1'

554177

Institutional Source

Beutler Lab

Gene Symbol

Nphp1

Ensembl Gene

ENSMUSG00000027378

Gene Name

nephronophthisis 1 (juvenile) homolog (human)

Synonyms

nephrocystin

MMRRC Submission

045254-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7152 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

127582652-127630817 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 127595899 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 522 (M522T)

Ref Sequence

ENSEMBL: ENSMUSP00000028857 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028857] [ENSMUST00000110357]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000028857
AA Change: M522T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000028857
Gene: ENSMUSG00000027378
AA Change: M522T

Domain	Start	End	E-Value	Type
low complexity region	118	143	N/A	INTRINSIC
SH3	158	214	5.91e-19	SMART
low complexity region	220	246	N/A	INTRINSIC
Blast:14_3_3	391	491	3e-55	BLAST
low complexity region	634	641	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110357
AA Change: M521T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000105986
Gene: ENSMUSG00000027378
AA Change: M521T

Domain	Start	End	E-Value	Type
low complexity region	118	143	N/A	INTRINSIC
SH3	158	214	5.91e-19	SMART
low complexity region	220	246	N/A	INTRINSIC
Blast:14_3_3	390	490	3e-55	BLAST
low complexity region	633	640	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

100% (53/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with src homology domain 3 (SH3) patterns. This protein interacts with Crk-associated substrate, and it appears to function in the control of cell division, as well as in cell-cell and cell-matrix adhesion signaling, likely as part of a multifunctional complex localized in actin- and microtubule-based structures. Mutations in this gene cause familial juvenile nephronophthisis type 1, a kidney disorder involving both tubules and glomeruli. Defects in this gene are also associated with Senior-Loken syndrome type 1, also referred to as juvenile nephronophthisis with Leber amaurosis, which is characterized by kidney and eye disease, and with Joubert syndrome type 4, which is characterized by cerebellar ataxia, oculomotor apraxia, psychomotor delay and neonatal breathing abnormalities, sometimes including retinal dystrophy and renal disease. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit male infertility due to defects in sperm maturation. Mice homozygous for another knock-out allele exhibit absent photoreceptor outer segment and photoreceptor degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Btnl10	A	G	11: 58,813,223 (GRCm39)	N284S	probably benign	Het
Casz1	C	G	4: 148,985,748 (GRCm39)		probably benign	Het
Cdkn2c	A	T	4: 109,522,235 (GRCm39)	F37I	probably damaging	Het
Cdyl2	T	C	8: 117,351,066 (GRCm39)	K22E	probably damaging	Het
Cers1	T	C	8: 70,770,901 (GRCm39)	W104R	probably damaging	Het
Cgrrf1	T	A	14: 47,090,934 (GRCm39)	Y223*	probably null	Het
Cited2	C	A	10: 17,600,134 (GRCm39)	N147K	probably benign	Het
Clip2	A	T	5: 134,525,095 (GRCm39)	L904Q	probably damaging	Het
Cntln	T	C	4: 84,802,937 (GRCm39)	V79A	possibly damaging	Het
Cntnap1	C	T	11: 101,068,152 (GRCm39)	R55W	probably damaging	Het
Cspg4b	T	C	13: 113,455,384 (GRCm39)	F477L		Het
Ctnna2	T	A	6: 76,957,807 (GRCm39)	T481S	possibly damaging	Het
Ddx17	T	C	15: 79,414,464 (GRCm39)	T570A	possibly damaging	Het
Epha7	A	G	4: 28,935,826 (GRCm39)	K483E	possibly damaging	Het
Eps8l2	A	T	7: 140,935,678 (GRCm39)	I150F	possibly damaging	Het
Esyt1	A	G	10: 128,351,629 (GRCm39)	S827P	possibly damaging	Het
Fbxl13	T	A	5: 21,787,065 (GRCm39)	I291F	possibly damaging	Het
Foxd3	A	C	4: 99,545,562 (GRCm39)	H234P	probably benign	Het
Ggta1	T	A	2: 35,292,711 (GRCm39)	M199L	probably benign	Het
H3c13	A	G	3: 96,176,254 (GRCm39)	D82G	probably benign	Het
Ighv5-15	T	C	12: 113,790,317 (GRCm39)	E101G	probably benign	Het
Igkv8-18	T	C	6: 70,333,205 (GRCm39)	L49P	probably damaging	Het
Itpr1	T	C	6: 108,371,368 (GRCm39)		probably null	Het
Klhl36	C	T	8: 120,596,953 (GRCm39)	T218M	probably benign	Het
Ltn1	A	G	16: 87,224,529 (GRCm39)	F65S	probably damaging	Het
Marchf3	A	G	18: 56,909,053 (GRCm39)	V244A	probably benign	Het
Myl10	G	C	5: 136,726,825 (GRCm39)	V70L	probably benign	Het
Ndst3	T	A	3: 123,346,305 (GRCm39)	I642F	possibly damaging	Het
Neb	T	C	2: 52,153,557 (GRCm39)	D2456G	probably damaging	Het
Or51k1	T	A	7: 103,661,226 (GRCm39)	M228L	probably benign	Het
Or8k33	C	T	2: 86,383,673 (GRCm39)	S265N	probably benign	Het
Pam	T	A	1: 97,813,465 (GRCm39)	M322L	probably damaging	Het
Pcdhgb1	C	A	18: 37,814,854 (GRCm39)	H448Q	probably benign	Het
Pcnt	T	C	10: 76,247,194 (GRCm39)		probably null	Het
Pgm3	A	T	9: 86,449,593 (GRCm39)	D142E	probably benign	Het
Pomgnt2	C	T	9: 121,812,589 (GRCm39)	G64D	probably damaging	Het
Sds	A	T	5: 120,619,716 (GRCm39)		probably null	Het
Sirpb1b	G	T	3: 15,607,230 (GRCm39)	Q351K	probably benign	Het
Slc2a12	T	A	10: 22,541,453 (GRCm39)	M436K	probably benign	Het
Slc9a5	G	A	8: 106,095,025 (GRCm39)	G872D	probably benign	Het
Stxbp2	T	G	8: 3,682,583 (GRCm39)	S57R	probably benign	Het
Sult2a6	T	A	7: 13,956,445 (GRCm39)	D272V	probably benign	Het
Supt5	A	G	7: 28,023,325 (GRCm39)	M318T	probably benign	Het
Tdpoz3	T	C	3: 93,733,772 (GRCm39)	V149A	probably damaging	Het
Tead2	T	A	7: 44,869,871 (GRCm39)	S124T	possibly damaging	Het
Tssc4	T	A	7: 142,624,139 (GRCm39)	V149D	probably damaging	Het
Ttn	C	T	2: 76,683,505 (GRCm39)	A906T		Het
Uspl1	A	G	5: 149,124,588 (GRCm39)	T2A	possibly damaging	Het
Vmn1r124	G	A	7: 20,994,184 (GRCm39)	P120L	probably benign	Het
Vmn1r37	T	C	6: 66,708,883 (GRCm39)	Y170H	probably benign	Het
Vnn3	T	A	10: 23,727,513 (GRCm39)	V11E	possibly damaging	Het
Zbtb7b	C	T	3: 89,288,209 (GRCm39)	R203H	probably benign	Het
Zfhx3	T	C	8: 109,674,839 (GRCm39)	V1963A	possibly damaging	Het
Zfp324	C	A	7: 12,700,198 (GRCm39)	A19E	probably benign	Het
Zfyve26	T	C	12: 79,325,888 (GRCm39)	S784G	probably benign	Het

Other mutations in Nphp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00570:Nphp1	APN	2	127,605,805 (GRCm39)	missense	probably damaging	0.99
IGL00589:Nphp1	APN	2	127,605,769 (GRCm39)	missense	probably damaging	1.00
IGL01143:Nphp1	APN	2	127,622,056 (GRCm39)	missense	probably benign	0.06
IGL01893:Nphp1	APN	2	127,611,564 (GRCm39)	missense	probably damaging	1.00
IGL01922:Nphp1	APN	2	127,621,989 (GRCm39)	missense	possibly damaging	0.95
IGL02123:Nphp1	APN	2	127,595,969 (GRCm39)	missense	probably benign	0.03
IGL02340:Nphp1	APN	2	127,621,987 (GRCm39)	nonsense	probably null
IGL02836:Nphp1	APN	2	127,611,543 (GRCm39)	missense	probably benign	0.00
IGL03109:Nphp1	APN	2	127,610,089 (GRCm39)	critical splice donor site	probably benign
R1632:Nphp1	UTSW	2	127,612,312 (GRCm39)	missense	probably benign	0.32
R1857:Nphp1	UTSW	2	127,612,296 (GRCm39)	missense	probably benign	0.00
R4425:Nphp1	UTSW	2	127,630,719 (GRCm39)	missense	possibly damaging	0.82
R4514:Nphp1	UTSW	2	127,590,007 (GRCm39)	missense	probably benign	0.26
R4546:Nphp1	UTSW	2	127,607,939 (GRCm39)	splice site	probably null
R4580:Nphp1	UTSW	2	127,610,089 (GRCm39)	critical splice donor site	probably null
R5634:Nphp1	UTSW	2	127,601,570 (GRCm39)	missense	possibly damaging	0.81
R7326:Nphp1	UTSW	2	127,603,137 (GRCm39)	missense	possibly damaging	0.76
R7985:Nphp1	UTSW	2	127,587,829 (GRCm39)	missense	probably damaging	0.97
R8029:Nphp1	UTSW	2	127,583,036 (GRCm39)	missense	probably benign	0.00
R8715:Nphp1	UTSW	2	127,605,729 (GRCm39)	missense	possibly damaging	0.91
R8967:Nphp1	UTSW	2	127,582,897 (GRCm39)	missense	probably damaging	1.00
R8997:Nphp1	UTSW	2	127,595,982 (GRCm39)	missense	possibly damaging	0.88
R9328:Nphp1	UTSW	2	127,582,892 (GRCm39)	missense	possibly damaging	0.77
R9450:Nphp1	UTSW	2	127,616,008 (GRCm39)	missense
R9755:Nphp1	UTSW	2	127,595,951 (GRCm39)	nonsense	probably null
X0022:Nphp1	UTSW	2	127,603,134 (GRCm39)	missense	probably damaging	1.00
X0025:Nphp1	UTSW	2	127,621,047 (GRCm39)	missense	probably benign	0.16

Predicted Primers

PCR Primer
(F):5'- AGCCTCGCCTATTCAAGAGC -3'
(R):5'- CACTGGCTGTAGATTCTCATTGAATG -3'

Sequencing Primer
(F):5'- CTAGAAGATGGTATTGGATCCCC -3'
(R):5'- AATGTGTGTTTGAATGAACGCC -3'

Posted On

2019-05-15