Incidental Mutation 'R7152:Cntln'
ID554183
Institutional Source Beutler Lab
Gene Symbol Cntln
Ensembl Gene ENSMUSG00000038070
Gene Namecentlein, centrosomal protein
SynonymsB430108F07Rik, D530005L17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.350) question?
Stock #R7152 (G1)
Quality Score205.009
Status Validated
Chromosome4
Chromosomal Location84884309-85131921 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84884700 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 79 (V79A)
Ref Sequence ENSEMBL: ENSMUSP00000099883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047023] [ENSMUST00000102819] [ENSMUST00000169371]
Predicted Effect probably benign
Transcript: ENSMUST00000047023
AA Change: V79A

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000044138
Gene: ENSMUSG00000038070
AA Change: V79A

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
internal_repeat_1 198 219 1.25e-5 PROSPERO
low complexity region 242 251 N/A INTRINSIC
internal_repeat_1 321 342 1.25e-5 PROSPERO
low complexity region 346 358 N/A INTRINSIC
coiled coil region 404 433 N/A INTRINSIC
low complexity region 434 446 N/A INTRINSIC
coiled coil region 458 481 N/A INTRINSIC
coiled coil region 516 584 N/A INTRINSIC
coiled coil region 606 648 N/A INTRINSIC
coiled coil region 674 780 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 973 1114 N/A INTRINSIC
low complexity region 1206 1217 N/A INTRINSIC
Blast:HisKA 1270 1326 1e-24 BLAST
low complexity region 1327 1348 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102819
AA Change: V79A

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099883
Gene: ENSMUSG00000038070
AA Change: V79A

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
coiled coil region 166 277 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169371
AA Change: V79A

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000130491
Gene: ENSMUSG00000038070
AA Change: V79A

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
internal_repeat_1 198 219 1.24e-5 PROSPERO
low complexity region 242 251 N/A INTRINSIC
internal_repeat_1 321 342 1.24e-5 PROSPERO
low complexity region 346 358 N/A INTRINSIC
coiled coil region 404 433 N/A INTRINSIC
low complexity region 434 446 N/A INTRINSIC
coiled coil region 458 481 N/A INTRINSIC
coiled coil region 516 584 N/A INTRINSIC
coiled coil region 606 648 N/A INTRINSIC
coiled coil region 674 780 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 972 1113 N/A INTRINSIC
low complexity region 1205 1216 N/A INTRINSIC
Blast:HisKA 1269 1325 1e-24 BLAST
low complexity region 1326 1347 N/A INTRINSIC
Meta Mutation Damage Score 0.0652 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
BC067074 T C 13: 113,318,850 F477L Het
Btnl10 A G 11: 58,922,397 N284S probably benign Het
Casz1 C G 4: 148,901,291 probably benign Het
Cdkn2c A T 4: 109,665,038 F37I probably damaging Het
Cdyl2 T C 8: 116,624,327 K22E probably damaging Het
Cers1 T C 8: 70,318,251 W104R probably damaging Het
Cgrrf1 T A 14: 46,853,477 Y223* probably null Het
Cited2 C A 10: 17,724,386 N147K probably benign Het
Clip2 A T 5: 134,496,241 L904Q probably damaging Het
Cntnap1 C T 11: 101,177,326 R55W probably damaging Het
Ctnna2 T A 6: 76,980,824 T481S possibly damaging Het
Ddx17 T C 15: 79,530,263 T570A possibly damaging Het
Epha7 A G 4: 28,935,826 K483E possibly damaging Het
Eps8l2 A T 7: 141,355,765 I150F possibly damaging Het
Esyt1 A G 10: 128,515,760 S827P possibly damaging Het
Fbxl13 T A 5: 21,582,067 I291F possibly damaging Het
Foxd3 A C 4: 99,657,325 H234P probably benign Het
Ggta1 T A 2: 35,402,699 M199L probably benign Het
Hist2h3b A G 3: 96,268,938 D82G probably benign Het
Ighv5-15 T C 12: 113,826,697 E101G probably benign Het
Igkv8-18 T C 6: 70,356,221 L49P probably damaging Het
Itpr1 T C 6: 108,394,407 probably null Het
Klhl36 C T 8: 119,870,214 T218M probably benign Het
Ltn1 A G 16: 87,427,641 F65S probably damaging Het
March3 A G 18: 56,775,981 V244A probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Ndst3 T A 3: 123,552,656 I642F possibly damaging Het
Neb T C 2: 52,263,545 D2456G probably damaging Het
Nphp1 A G 2: 127,753,979 M522T probably benign Het
Olfr1080 C T 2: 86,553,329 S265N probably benign Het
Olfr639 T A 7: 104,012,019 M228L probably benign Het
Pam T A 1: 97,885,740 M322L probably damaging Het
Pcdhgb1 C A 18: 37,681,801 H448Q probably benign Het
Pcnt T C 10: 76,411,360 probably null Het
Pgm3 A T 9: 86,567,540 D142E probably benign Het
Pomgnt2 C T 9: 121,983,523 G64D probably damaging Het
Sds A T 5: 120,481,651 probably null Het
Sirpb1b G T 3: 15,542,170 Q351K probably benign Het
Slc2a12 T A 10: 22,665,554 M436K probably benign Het
Slc9a5 G A 8: 105,368,393 G872D probably benign Het
Stxbp2 T G 8: 3,632,583 S57R probably benign Het
Sult2a6 T A 7: 14,222,520 D272V probably benign Het
Supt5 A G 7: 28,323,900 M318T probably benign Het
Tdpoz3 T C 3: 93,826,465 V149A probably damaging Het
Tead2 T A 7: 45,220,447 S124T possibly damaging Het
Tssc4 T A 7: 143,070,402 V149D probably damaging Het
Ttn C T 2: 76,853,161 A906T Het
Uspl1 A G 5: 149,187,778 T2A possibly damaging Het
Vmn1r124 G A 7: 21,260,259 P120L probably benign Het
Vmn1r37 T C 6: 66,731,899 Y170H probably benign Het
Vnn3 T A 10: 23,851,615 V11E possibly damaging Het
Zbtb7b C T 3: 89,380,902 R203H probably benign Het
Zfhx3 T C 8: 108,948,207 V1963A possibly damaging Het
Zfp324 C A 7: 12,966,271 A19E probably benign Het
Zfyve26 T C 12: 79,279,114 S784G probably benign Het
Other mutations in Cntln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Cntln APN 4 85006434 missense probably benign 0.25
IGL00743:Cntln APN 4 84979415 missense probably benign 0.06
IGL01014:Cntln APN 4 85049908 missense probably benign 0.25
IGL02217:Cntln APN 4 85100258 missense probably damaging 1.00
IGL02323:Cntln APN 4 85049789 missense probably benign 0.00
IGL02353:Cntln APN 4 85049850 missense probably damaging 0.98
IGL02360:Cntln APN 4 85049850 missense probably damaging 0.98
IGL02616:Cntln APN 4 85115452 critical splice donor site probably null
PIT4696001:Cntln UTSW 4 84974000 missense probably damaging 0.99
R0110:Cntln UTSW 4 85096757 missense probably damaging 1.00
R0324:Cntln UTSW 4 85092695 missense probably damaging 0.98
R0349:Cntln UTSW 4 84996485 missense probably damaging 1.00
R0519:Cntln UTSW 4 85005053 splice site probably benign
R0529:Cntln UTSW 4 85067825 missense probably damaging 1.00
R0582:Cntln UTSW 4 84884741 missense probably damaging 1.00
R1077:Cntln UTSW 4 84996479 missense probably damaging 1.00
R1345:Cntln UTSW 4 84973991 missense probably damaging 1.00
R1457:Cntln UTSW 4 85096839 missense probably benign 0.33
R1571:Cntln UTSW 4 84947586 nonsense probably null
R1622:Cntln UTSW 4 85063181 missense probably damaging 1.00
R1681:Cntln UTSW 4 84947635 missense probably damaging 1.00
R1777:Cntln UTSW 4 85130679 missense probably benign 0.23
R1808:Cntln UTSW 4 85096763 missense probably damaging 1.00
R1882:Cntln UTSW 4 85100835 missense probably damaging 1.00
R2056:Cntln UTSW 4 85049674 missense probably benign
R2965:Cntln UTSW 4 84974027 critical splice donor site probably null
R2968:Cntln UTSW 4 84957267 missense probably benign 0.27
R3104:Cntln UTSW 4 84957169 missense possibly damaging 0.95
R3106:Cntln UTSW 4 84957169 missense possibly damaging 0.95
R3121:Cntln UTSW 4 85005052 splice site probably benign
R3617:Cntln UTSW 4 85004977 nonsense probably null
R4009:Cntln UTSW 4 85063215 missense probably benign 0.45
R4036:Cntln UTSW 4 85006488 missense probably damaging 1.00
R4548:Cntln UTSW 4 85096842 missense probably benign 0.27
R4592:Cntln UTSW 4 84971182 missense probably benign 0.00
R4666:Cntln UTSW 4 84971216 missense probably benign 0.13
R4826:Cntln UTSW 4 85005044 missense probably benign 0.03
R4836:Cntln UTSW 4 85049720 nonsense probably null
R4856:Cntln UTSW 4 84971229 missense probably benign 0.35
R4886:Cntln UTSW 4 84971229 missense probably benign 0.35
R4995:Cntln UTSW 4 85049883 missense probably benign 0.00
R5090:Cntln UTSW 4 84947593 missense probably damaging 0.98
R5202:Cntln UTSW 4 84971229 missense probably benign 0.35
R5905:Cntln UTSW 4 84971173 missense probably benign 0.03
R5953:Cntln UTSW 4 85049919 missense possibly damaging 0.92
R6028:Cntln UTSW 4 84971173 missense probably benign 0.03
R6298:Cntln UTSW 4 85096761 missense probably damaging 1.00
R6351:Cntln UTSW 4 85115354 missense probably damaging 0.99
R6371:Cntln UTSW 4 84884579 missense probably damaging 0.98
R6481:Cntln UTSW 4 85067510 missense probably benign 0.00
R6864:Cntln UTSW 4 85096792 missense probably damaging 0.99
R6874:Cntln UTSW 4 85067759 missense probably damaging 1.00
R6919:Cntln UTSW 4 85115368 missense probably benign 0.04
R7071:Cntln UTSW 4 85100385 missense probably damaging 1.00
R7113:Cntln UTSW 4 85049827 missense probably damaging 0.98
R7253:Cntln UTSW 4 85118473 missense probably damaging 1.00
R7289:Cntln UTSW 4 85046303 missense possibly damaging 0.80
R7440:Cntln UTSW 4 85063216 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GGAGTTTTCAAGCGGGAACTTG -3'
(R):5'- AAATCGAAACCCGGGTCTGC -3'

Sequencing Primer
(F):5'- AACTTGACCCGTTAGGCG -3'
(R):5'- AGGGTTCACTAGGTGCCC -3'
Posted On2019-05-15