Incidental Mutation 'R0601:Dhx30'
ID55421
Institutional Source Beutler Lab
Gene Symbol Dhx30
Ensembl Gene ENSMUSG00000032480
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 30
SynonymsDdx30, 2810477H02Rik, C130058C04Rik
MMRRC Submission 038790-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.900) question?
Stock #R0601 (G1)
Quality Score177
Status Validated
Chromosome9
Chromosomal Location110084320-110117830 bp(-) (GRCm38)
Type of Mutationunclassified (4564 bp from exon)
DNA Base Change (assembly) A to G at 110086714 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000035055] [ENSMUST00000062368] [ENSMUST00000111991] [ENSMUST00000163979] [ENSMUST00000164930] [ENSMUST00000165596] [ENSMUST00000165876] [ENSMUST00000196171] [ENSMUST00000197928] [ENSMUST00000198425] [ENSMUST00000198511] [ENSMUST00000199161] [ENSMUST00000199461] [ENSMUST00000199498] [ENSMUST00000199529] [ENSMUST00000199548] [ENSMUST00000199693] [ENSMUST00000200066]
Predicted Effect probably null
Transcript: ENSMUST00000035055
SMART Domains Protein: ENSMUSP00000035055
Gene: ENSMUSG00000032479

DomainStartEndE-ValueType
low complexity region 254 265 N/A INTRINSIC
internal_repeat_1 266 379 4.96e-7 PROSPERO
low complexity region 401 420 N/A INTRINSIC
internal_repeat_1 439 550 4.96e-7 PROSPERO
low complexity region 659 674 N/A INTRINSIC
low complexity region 720 742 N/A INTRINSIC
low complexity region 760 775 N/A INTRINSIC
low complexity region 879 889 N/A INTRINSIC
Pfam:Tubulin-binding 903 926 2e-12 PFAM
Pfam:Tubulin-binding 965 995 4.9e-18 PFAM
Pfam:Tubulin-binding 996 1026 7.4e-18 PFAM
Pfam:Tubulin-binding 1027 1058 4.4e-15 PFAM
low complexity region 1093 1108 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000062368
SMART Domains Protein: ENSMUSP00000062622
Gene: ENSMUSG00000032480

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
low complexity region 48 64 N/A INTRINSIC
internal_repeat_1 76 123 2.53e-5 PROSPERO
low complexity region 217 228 N/A INTRINSIC
internal_repeat_1 268 314 2.53e-5 PROSPERO
low complexity region 321 342 N/A INTRINSIC
DEXDc 461 650 9.66e-29 SMART
low complexity region 679 689 N/A INTRINSIC
HELICc 711 816 1.63e-17 SMART
HA2 879 969 5.16e-22 SMART
Pfam:OB_NTP_bind 984 1134 5.7e-9 PFAM
low complexity region 1200 1208 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111991
SMART Domains Protein: ENSMUSP00000107622
Gene: ENSMUSG00000032480

DomainStartEndE-ValueType
internal_repeat_1 47 94 6.21e-5 PROSPERO
low complexity region 188 199 N/A INTRINSIC
internal_repeat_1 239 285 6.21e-5 PROSPERO
low complexity region 292 313 N/A INTRINSIC
DEXDc 432 621 9.66e-29 SMART
low complexity region 650 660 N/A INTRINSIC
HELICc 682 787 1.63e-17 SMART
HA2 850 940 5.16e-22 SMART
Pfam:OB_NTP_bind 952 1106 2.1e-7 PFAM
low complexity region 1171 1179 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000163979
SMART Domains Protein: ENSMUSP00000129362
Gene: ENSMUSG00000032479

DomainStartEndE-ValueType
low complexity region 9 17 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 365 376 N/A INTRINSIC
low complexity region 506 521 N/A INTRINSIC
low complexity region 567 589 N/A INTRINSIC
low complexity region 607 622 N/A INTRINSIC
low complexity region 726 736 N/A INTRINSIC
Pfam:Tubulin-binding 743 773 5.8e-16 PFAM
Pfam:Tubulin-binding 774 804 2.2e-18 PFAM
Pfam:Tubulin-binding 805 836 1.6e-11 PFAM
low complexity region 871 886 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000164930
SMART Domains Protein: ENSMUSP00000131285
Gene: ENSMUSG00000032479

DomainStartEndE-ValueType
low complexity region 9 17 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 365 376 N/A INTRINSIC
low complexity region 506 521 N/A INTRINSIC
low complexity region 567 589 N/A INTRINSIC
low complexity region 607 622 N/A INTRINSIC
low complexity region 726 736 N/A INTRINSIC
Pfam:Tubulin-binding 743 773 6e-16 PFAM
Pfam:Tubulin-binding 774 804 4.5e-19 PFAM
Pfam:Tubulin-binding 805 835 2.3e-18 PFAM
Pfam:Tubulin-binding 836 867 1.6e-11 PFAM
low complexity region 902 917 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165596
SMART Domains Protein: ENSMUSP00000129174
Gene: ENSMUSG00000032480

DomainStartEndE-ValueType
internal_repeat_1 70 117 6.77e-5 PROSPERO
low complexity region 211 222 N/A INTRINSIC
internal_repeat_1 262 308 6.77e-5 PROSPERO
low complexity region 315 336 N/A INTRINSIC
DEXDc 455 644 9.66e-29 SMART
low complexity region 673 683 N/A INTRINSIC
HELICc 705 810 1.63e-17 SMART
HA2 873 963 5.16e-22 SMART
Pfam:OB_NTP_bind 975 1129 1.8e-7 PFAM
low complexity region 1194 1202 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000165876
SMART Domains Protein: ENSMUSP00000132662
Gene: ENSMUSG00000032479

DomainStartEndE-ValueType
low complexity region 254 265 N/A INTRINSIC
internal_repeat_1 266 379 4.95e-7 PROSPERO
low complexity region 401 420 N/A INTRINSIC
internal_repeat_1 439 550 4.95e-7 PROSPERO
low complexity region 659 674 N/A INTRINSIC
low complexity region 720 742 N/A INTRINSIC
low complexity region 760 775 N/A INTRINSIC
low complexity region 879 889 N/A INTRINSIC
Pfam:Tubulin-binding 896 926 8.5e-16 PFAM
Pfam:Tubulin-binding 965 995 6.4e-19 PFAM
Pfam:Tubulin-binding 996 1026 3.3e-18 PFAM
Pfam:Tubulin-binding 1027 1058 2.3e-11 PFAM
low complexity region 1093 1108 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196171
SMART Domains Protein: ENSMUSP00000143616
Gene: ENSMUSG00000032480

DomainStartEndE-ValueType
internal_repeat_1 39 86 5.84e-5 PROSPERO
low complexity region 180 191 N/A INTRINSIC
internal_repeat_1 231 277 5.84e-5 PROSPERO
low complexity region 284 305 N/A INTRINSIC
DEXDc 424 613 9.66e-29 SMART
low complexity region 642 652 N/A INTRINSIC
HELICc 674 779 1.63e-17 SMART
HA2 842 932 5.16e-22 SMART
Pfam:OB_NTP_bind 947 1097 2.8e-9 PFAM
low complexity region 1163 1171 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196182
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196914
Predicted Effect probably benign
Transcript: ENSMUST00000197928
SMART Domains Protein: ENSMUSP00000142549
Gene: ENSMUSG00000032480

DomainStartEndE-ValueType
internal_repeat_1 47 94 6.21e-5 PROSPERO
low complexity region 188 199 N/A INTRINSIC
internal_repeat_1 239 285 6.21e-5 PROSPERO
low complexity region 292 313 N/A INTRINSIC
DEXDc 432 621 9.66e-29 SMART
low complexity region 650 660 N/A INTRINSIC
HELICc 682 787 1.63e-17 SMART
HA2 850 940 5.16e-22 SMART
Pfam:OB_NTP_bind 952 1106 2.1e-7 PFAM
low complexity region 1171 1179 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198026
Predicted Effect probably benign
Transcript: ENSMUST00000198425
SMART Domains Protein: ENSMUSP00000142659
Gene: ENSMUSG00000032480

DomainStartEndE-ValueType
internal_repeat_1 70 117 6.77e-5 PROSPERO
low complexity region 211 222 N/A INTRINSIC
internal_repeat_1 262 308 6.77e-5 PROSPERO
low complexity region 315 336 N/A INTRINSIC
DEXDc 455 644 9.66e-29 SMART
low complexity region 673 683 N/A INTRINSIC
HELICc 705 810 1.63e-17 SMART
HA2 873 963 5.16e-22 SMART
Pfam:OB_NTP_bind 975 1129 1.8e-7 PFAM
low complexity region 1194 1202 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000198511
SMART Domains Protein: ENSMUSP00000142558
Gene: ENSMUSG00000032479

DomainStartEndE-ValueType
low complexity region 7 17 N/A INTRINSIC
Pfam:Tubulin-binding 24 54 7.3e-14 PFAM
Pfam:Tubulin-binding 55 85 5.3e-17 PFAM
Pfam:Tubulin-binding 86 116 2.8e-16 PFAM
Pfam:Tubulin-binding 117 148 1.9e-9 PFAM
low complexity region 183 198 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000199161
SMART Domains Protein: ENSMUSP00000143205
Gene: ENSMUSG00000032479

DomainStartEndE-ValueType
Pfam:Tubulin-binding 16 46 6.7e-14 PFAM
Pfam:Tubulin-binding 47 77 4.9e-17 PFAM
Pfam:Tubulin-binding 78 108 2.5e-16 PFAM
Pfam:Tubulin-binding 109 140 1.7e-9 PFAM
low complexity region 176 191 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199332
Predicted Effect probably null
Transcript: ENSMUST00000199461
SMART Domains Protein: ENSMUSP00000143296
Gene: ENSMUSG00000032479

DomainStartEndE-ValueType
low complexity region 99 109 N/A INTRINSIC
Pfam:Tubulin-binding 116 146 1e-13 PFAM
Pfam:Tubulin-binding 147 177 3.8e-16 PFAM
Pfam:Tubulin-binding 178 209 2.6e-9 PFAM
low complexity region 244 259 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000199498
SMART Domains Protein: ENSMUSP00000142439
Gene: ENSMUSG00000032479

DomainStartEndE-ValueType
low complexity region 9 17 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 365 376 N/A INTRINSIC
low complexity region 506 521 N/A INTRINSIC
low complexity region 567 589 N/A INTRINSIC
low complexity region 607 622 N/A INTRINSIC
low complexity region 726 736 N/A INTRINSIC
Pfam:Tubulin-binding 743 773 5.8e-16 PFAM
Pfam:Tubulin-binding 774 804 2.2e-18 PFAM
Pfam:Tubulin-binding 805 836 1.6e-11 PFAM
low complexity region 871 886 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199529
SMART Domains Protein: ENSMUSP00000142489
Gene: ENSMUSG00000032480

DomainStartEndE-ValueType
internal_repeat_1 47 94 6.21e-5 PROSPERO
low complexity region 188 199 N/A INTRINSIC
internal_repeat_1 239 285 6.21e-5 PROSPERO
low complexity region 292 313 N/A INTRINSIC
DEXDc 432 621 9.66e-29 SMART
low complexity region 650 660 N/A INTRINSIC
HELICc 682 787 1.63e-17 SMART
HA2 850 940 5.16e-22 SMART
Pfam:OB_NTP_bind 952 1106 2.1e-7 PFAM
low complexity region 1171 1179 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000199548
SMART Domains Protein: ENSMUSP00000143408
Gene: ENSMUSG00000032479

DomainStartEndE-ValueType
low complexity region 99 109 N/A INTRINSIC
Pfam:Tubulin-binding 116 146 1.1e-13 PFAM
Pfam:Tubulin-binding 147 177 7.9e-17 PFAM
Pfam:Tubulin-binding 178 208 4.1e-16 PFAM
Pfam:Tubulin-binding 209 240 2.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199693
Predicted Effect probably null
Transcript: ENSMUST00000199985
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200029
Predicted Effect probably benign
Transcript: ENSMUST00000200066
SMART Domains Protein: ENSMUSP00000143371
Gene: ENSMUSG00000032480

DomainStartEndE-ValueType
internal_repeat_1 47 94 6.21e-5 PROSPERO
low complexity region 188 199 N/A INTRINSIC
internal_repeat_1 239 285 6.21e-5 PROSPERO
low complexity region 292 313 N/A INTRINSIC
DEXDc 432 621 9.66e-29 SMART
low complexity region 650 660 N/A INTRINSIC
HELICc 682 787 1.63e-17 SMART
HA2 850 940 5.16e-22 SMART
Pfam:OB_NTP_bind 952 1106 2.1e-7 PFAM
low complexity region 1171 1179 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000200480
Predicted Effect probably benign
Transcript: ENSMUST00000200593
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.2%
Validation Efficiency 98% (119/122)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The family member encoded by this gene is a mitochondrial nucleoid protein that associates with mitochondrial DNA. It has also been identified as a component of a transcriptional repressor complex that functions in retinal development, and it is required to optimize the function of the zinc-finger antiviral protein. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Feb 2013]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit complete embryonic lethality associated with embryonic growth retardation, failure of initiation of embryo turning, and absence of organized somites and neural tube formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 119 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930596D02Rik T G 14: 35,810,189 D143A probably damaging Het
Abca9 C T 11: 110,117,058 probably null Het
Abcc5 A G 16: 20,404,559 probably benign Het
Ablim3 T A 18: 61,849,370 D168V probably benign Het
Acsl3 C T 1: 78,696,179 S352F probably damaging Het
Adgrl4 A T 3: 151,498,429 probably benign Het
Arhgap29 A G 3: 121,991,110 K229E probably damaging Het
Atad3a A T 4: 155,747,407 V470D probably damaging Het
Atp8b1 A G 18: 64,571,653 probably null Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Bpifa5 A G 2: 154,164,255 N121S possibly damaging Het
Bpifb4 G A 2: 153,947,283 probably benign Het
Bptf T A 11: 107,061,692 T2112S probably benign Het
Btnl4 T C 17: 34,469,311 K498E probably benign Het
Calhm2 A G 19: 47,141,030 probably null Het
Capn3 A T 2: 120,502,596 probably null Het
Caps2 T C 10: 112,195,790 F265L possibly damaging Het
Casp3 G T 8: 46,636,227 C170F probably benign Het
Ccdc39 T C 3: 33,819,839 R615G probably damaging Het
Cd177 A G 7: 24,752,313 I426T probably benign Het
Cfap53 G A 18: 74,300,150 R102H possibly damaging Het
Cfhr3 G A 1: 139,593,885 noncoding transcript Het
Col7a1 T C 9: 108,980,584 probably benign Het
Cplx3 T C 9: 57,606,074 E24G possibly damaging Het
D11Wsu47e T A 11: 113,687,886 S36T probably benign Het
Dnah8 T A 17: 30,708,358 N1329K probably benign Het
Dnajc11 C G 4: 151,969,936 R200G probably damaging Het
Dok3 A T 13: 55,524,263 F201I probably benign Het
Dpf2 A T 19: 5,902,212 H303Q probably damaging Het
Dtnb A G 12: 3,735,039 probably benign Het
Elk3 T C 10: 93,265,481 E136G probably damaging Het
Ephb1 T C 9: 102,195,130 D150G probably damaging Het
Erbb3 A G 10: 128,577,012 S570P probably benign Het
F2 A T 2: 91,633,311 probably null Het
Fanca A T 8: 123,308,513 M231K probably damaging Het
Fbxo34 T C 14: 47,530,257 V358A probably benign Het
Foxp1 C T 6: 98,930,122 E666K probably damaging Het
Fto A G 8: 91,401,802 probably null Het
Gbp2 C T 3: 142,630,758 R290C possibly damaging Het
Grik2 T G 10: 49,422,597 S343R probably damaging Het
Heatr5b A T 17: 78,768,545 M1448K probably benign Het
Hmgn3 A T 9: 83,146,429 probably null Het
Htt T C 5: 34,846,003 V1274A probably benign Het
Kcnh8 A G 17: 52,894,005 D489G probably damaging Het
Kcnip3 A T 2: 127,458,397 probably benign Het
Kdm5a A G 6: 120,402,671 T647A possibly damaging Het
Krt72 T C 15: 101,786,056 R135G probably damaging Het
Larp7 T A 3: 127,544,209 K400N probably damaging Het
Lifr T C 15: 7,169,272 probably null Het
Lima1 G A 15: 99,780,472 P696L probably damaging Het
Lrrc8e T G 8: 4,235,239 probably null Het
Map1a A G 2: 121,298,602 R116G probably damaging Het
Map3k13 A G 16: 21,905,249 E327G possibly damaging Het
Med13 A G 11: 86,345,962 V123A possibly damaging Het
Megf8 A C 7: 25,328,540 H205P probably benign Het
Met G A 6: 17,555,632 probably null Het
Mfsd14b A C 13: 65,087,150 V71G possibly damaging Het
Mpl T A 4: 118,443,536 T599S probably benign Het
Myh15 A T 16: 49,061,581 D62V probably damaging Het
Myo5a A G 9: 75,174,015 T961A probably benign Het
Myrfl A G 10: 116,776,760 Y895H probably damaging Het
Nap1l1 T C 10: 111,490,363 probably benign Het
Ncapd3 T A 9: 27,041,507 Y111N probably benign Het
Nlrc3 A G 16: 3,948,249 probably benign Het
Nsun2 G T 13: 69,633,242 V657L probably benign Het
Olfr1026 A T 2: 85,923,378 I37F probably benign Het
Olfr1247 T A 2: 89,609,220 N294I probably benign Het
Olfr142 T C 2: 90,252,934 D18G probably benign Het
Olfr1511 C A 14: 52,389,826 G316* probably null Het
Olfr195 G A 16: 59,149,754 M301I probably benign Het
Olfr596 T C 7: 103,310,164 S148P probably damaging Het
Olfr646 A T 7: 104,107,142 I288F possibly damaging Het
Olfr780 T A 10: 129,322,016 M131K possibly damaging Het
Osbpl3 A T 6: 50,299,403 V795D probably benign Het
Osbpl5 T C 7: 143,709,549 D155G probably damaging Het
Parm1 G A 5: 91,594,264 V164I probably benign Het
Pgd A T 4: 149,156,810 probably benign Het
Pkp1 G A 1: 135,878,182 R593W probably damaging Het
Polr2l A T 7: 141,473,342 V53E probably damaging Het
Ppp4c G T 7: 126,787,288 T29K probably benign Het
Ppp4r4 T A 12: 103,600,520 probably benign Het
Ptprd A G 4: 76,100,474 S688P probably benign Het
Rab3b A T 4: 108,890,389 I28F probably damaging Het
Rnase4 T C 14: 51,105,095 L92P probably benign Het
Rnpc3 T C 3: 113,620,106 E229G probably benign Het
Rtraf A T 14: 19,816,206 D147E possibly damaging Het
Rttn G A 18: 89,042,966 G1086D probably benign Het
Ryr2 A G 13: 11,705,633 probably null Het
Sft2d2 T C 1: 165,183,861 I126V probably benign Het
Skap1 G T 11: 96,723,410 probably benign Het
Slc14a2 A T 18: 78,157,179 L753* probably null Het
Slc25a5 G A X: 36,795,755 A9T probably benign Het
Slc30a5 T C 13: 100,814,770 probably benign Het
Slc5a4b A C 10: 76,064,036 I456S possibly damaging Het
Slc9a4 A T 1: 40,603,070 S400C probably damaging Het
Slx1b T A 7: 126,692,640 H84L probably damaging Het
Sptbn1 T C 11: 30,150,008 Y190C probably damaging Het
Stk32b T C 5: 37,531,566 Q138R probably damaging Het
Syt6 C A 3: 103,620,890 D308E probably damaging Het
Sytl2 G A 7: 90,395,166 D572N probably damaging Het
Taok2 A T 7: 126,879,433 L109Q probably damaging Het
Tbl1xr1 T C 3: 22,179,319 probably benign Het
Tlk1 A G 2: 70,714,158 I711T probably benign Het
Trf A G 9: 103,222,933 probably null Het
Trpc2 A G 7: 102,084,365 T548A possibly damaging Het
Ttbk2 A T 2: 120,825,296 I29N possibly damaging Het
Tti1 A T 2: 157,993,372 C989S probably damaging Het
Txndc8 A G 4: 58,000,256 Y108H probably benign Het
Ugt2b1 A T 5: 86,917,680 V500D possibly damaging Het
Vmn1r34 A G 6: 66,637,664 I30T possibly damaging Het
Vmn2r115 A G 17: 23,360,100 K849R probably null Het
Vmn2r76 T A 7: 86,226,115 probably null Het
Vps13c T A 9: 67,927,472 S1694R probably benign Het
Wdfy3 G T 5: 101,836,172 P3509T probably benign Het
Wdr59 GGGTGGTG GGGTG 8: 111,480,540 probably benign Het
Wdr60 T C 12: 116,255,935 D129G possibly damaging Het
Wnt8b T A 19: 44,493,667 W40R probably benign Het
Xrra1 A G 7: 99,910,968 I384V possibly damaging Het
Zfp11 A T 5: 129,657,907 H163Q probably damaging Het
Other mutations in Dhx30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Dhx30 APN 9 110086245 missense probably benign 0.01
IGL01800:Dhx30 APN 9 110085513 missense possibly damaging 0.92
IGL02403:Dhx30 APN 9 110091519 missense probably damaging 1.00
IGL02869:Dhx30 APN 9 110097183 missense probably damaging 1.00
IGL03177:Dhx30 APN 9 110088010 missense possibly damaging 0.75
R0092:Dhx30 UTSW 9 110085010 missense possibly damaging 0.94
R1667:Dhx30 UTSW 9 110085445 missense possibly damaging 0.91
R1667:Dhx30 UTSW 9 110085446 missense possibly damaging 0.48
R1670:Dhx30 UTSW 9 110085273 missense possibly damaging 0.86
R1728:Dhx30 UTSW 9 110098751 missense probably damaging 0.98
R1729:Dhx30 UTSW 9 110098751 missense probably damaging 0.98
R1795:Dhx30 UTSW 9 110107983 splice site probably null
R1854:Dhx30 UTSW 9 110088672 missense probably damaging 1.00
R2191:Dhx30 UTSW 9 110086118 critical splice donor site probably null
R2219:Dhx30 UTSW 9 110087635 missense probably damaging 1.00
R2220:Dhx30 UTSW 9 110087635 missense probably damaging 1.00
R2267:Dhx30 UTSW 9 110087034 missense probably damaging 1.00
R2374:Dhx30 UTSW 9 110091564 missense probably damaging 0.98
R2568:Dhx30 UTSW 9 110097195 missense probably damaging 0.99
R2881:Dhx30 UTSW 9 110098845 nonsense probably null
R4022:Dhx30 UTSW 9 110084397 missense possibly damaging 0.90
R4052:Dhx30 UTSW 9 110100821 missense possibly damaging 0.46
R4695:Dhx30 UTSW 9 110085288 missense probably damaging 0.98
R4728:Dhx30 UTSW 9 110087650 missense probably damaging 1.00
R4892:Dhx30 UTSW 9 110085856 unclassified probably null
R4911:Dhx30 UTSW 9 110100924 missense probably damaging 1.00
R4937:Dhx30 UTSW 9 110085961 missense probably damaging 1.00
R5135:Dhx30 UTSW 9 110098795 missense probably damaging 1.00
R5359:Dhx30 UTSW 9 110093135 missense probably damaging 0.99
R5462:Dhx30 UTSW 9 110100974 missense probably damaging 0.97
R5504:Dhx30 UTSW 9 110085210 missense probably benign 0.08
R5797:Dhx30 UTSW 9 110098820 missense probably damaging 0.99
R5860:Dhx30 UTSW 9 110084577 missense probably damaging 0.98
R6041:Dhx30 UTSW 9 110084598 missense probably benign 0.09
R6132:Dhx30 UTSW 9 110085779 missense probably damaging 1.00
R6158:Dhx30 UTSW 9 110087030 missense probably damaging 1.00
R6475:Dhx30 UTSW 9 110085052 missense possibly damaging 0.91
R6818:Dhx30 UTSW 9 110088031 missense probably damaging 1.00
R6984:Dhx30 UTSW 9 110091417 critical splice donor site probably null
X0027:Dhx30 UTSW 9 110084434 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- ATAGCGTTCCTCCTTGTGCAGACC -3'
(R):5'- GATTTGGACCTTGTGACTGACCTGG -3'

Sequencing Primer
(F):5'- TTGTGCAGACCGCTGTC -3'
(R):5'- CATCTTACCAGGTGAGCGTC -3'
Posted On2013-07-11