Incidental Mutation 'R7152:Slc2a12'
ID554212
Institutional Source Beutler Lab
Gene Symbol Slc2a12
Ensembl Gene ENSMUSG00000037490
Gene Namesolute carrier family 2 (facilitated glucose transporter), member 12
SynonymsGlut12, GLUT-12
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7152 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location22645011-22704285 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 22665554 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 436 (M436K)
Ref Sequence ENSEMBL: ENSMUSP00000043962 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042261]
Predicted Effect probably benign
Transcript: ENSMUST00000042261
AA Change: M436K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000043962
Gene: ENSMUSG00000037490
AA Change: M436K

DomainStartEndE-ValueType
Pfam:MFS_1 42 390 5.3e-27 PFAM
Pfam:Sugar_tr 47 381 9.1e-76 PFAM
Pfam:Sugar_tr 451 569 4e-28 PFAM
Meta Mutation Damage Score 0.1356 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC2A12 belongs to a family of transporters that catalyze the uptake of sugars through facilitated diffusion (Rogers et al., 2002). This family of transporters show conservation of 12 transmembrane helices as well as functionally significant amino acid residues (Joost and Thorens, 2001 [PubMed 11780753]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
BC067074 T C 13: 113,318,850 F477L Het
Btnl10 A G 11: 58,922,397 N284S probably benign Het
Casz1 C G 4: 148,901,291 probably benign Het
Cdkn2c A T 4: 109,665,038 F37I probably damaging Het
Cdyl2 T C 8: 116,624,327 K22E probably damaging Het
Cers1 T C 8: 70,318,251 W104R probably damaging Het
Cgrrf1 T A 14: 46,853,477 Y223* probably null Het
Cited2 C A 10: 17,724,386 N147K probably benign Het
Clip2 A T 5: 134,496,241 L904Q probably damaging Het
Cntln T C 4: 84,884,700 V79A possibly damaging Het
Cntnap1 C T 11: 101,177,326 R55W probably damaging Het
Ctnna2 T A 6: 76,980,824 T481S possibly damaging Het
Ddx17 T C 15: 79,530,263 T570A possibly damaging Het
Epha7 A G 4: 28,935,826 K483E possibly damaging Het
Eps8l2 A T 7: 141,355,765 I150F possibly damaging Het
Esyt1 A G 10: 128,515,760 S827P possibly damaging Het
Fbxl13 T A 5: 21,582,067 I291F possibly damaging Het
Foxd3 A C 4: 99,657,325 H234P probably benign Het
Ggta1 T A 2: 35,402,699 M199L probably benign Het
Hist2h3b A G 3: 96,268,938 D82G probably benign Het
Ighv5-15 T C 12: 113,826,697 E101G probably benign Het
Igkv8-18 T C 6: 70,356,221 L49P probably damaging Het
Itpr1 T C 6: 108,394,407 probably null Het
Klhl36 C T 8: 119,870,214 T218M probably benign Het
Ltn1 A G 16: 87,427,641 F65S probably damaging Het
March3 A G 18: 56,775,981 V244A probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Ndst3 T A 3: 123,552,656 I642F possibly damaging Het
Neb T C 2: 52,263,545 D2456G probably damaging Het
Nphp1 A G 2: 127,753,979 M522T probably benign Het
Olfr1080 C T 2: 86,553,329 S265N probably benign Het
Olfr639 T A 7: 104,012,019 M228L probably benign Het
Pam T A 1: 97,885,740 M322L probably damaging Het
Pcdhgb1 C A 18: 37,681,801 H448Q probably benign Het
Pcnt T C 10: 76,411,360 probably null Het
Pgm3 A T 9: 86,567,540 D142E probably benign Het
Pomgnt2 C T 9: 121,983,523 G64D probably damaging Het
Sds A T 5: 120,481,651 probably null Het
Sirpb1b G T 3: 15,542,170 Q351K probably benign Het
Slc9a5 G A 8: 105,368,393 G872D probably benign Het
Stxbp2 T G 8: 3,632,583 S57R probably benign Het
Sult2a6 T A 7: 14,222,520 D272V probably benign Het
Supt5 A G 7: 28,323,900 M318T probably benign Het
Tdpoz3 T C 3: 93,826,465 V149A probably damaging Het
Tead2 T A 7: 45,220,447 S124T possibly damaging Het
Tssc4 T A 7: 143,070,402 V149D probably damaging Het
Ttn C T 2: 76,853,161 A906T Het
Uspl1 A G 5: 149,187,778 T2A possibly damaging Het
Vmn1r124 G A 7: 21,260,259 P120L probably benign Het
Vmn1r37 T C 6: 66,731,899 Y170H probably benign Het
Vnn3 T A 10: 23,851,615 V11E possibly damaging Het
Zbtb7b C T 3: 89,380,902 R203H probably benign Het
Zfhx3 T C 8: 108,948,207 V1963A possibly damaging Het
Zfp324 C A 7: 12,966,271 A19E probably benign Het
Zfyve26 T C 12: 79,279,114 S784G probably benign Het
Other mutations in Slc2a12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01392:Slc2a12 APN 10 22664684 missense probably damaging 0.97
IGL02472:Slc2a12 APN 10 22665155 missense probably damaging 1.00
IGL03387:Slc2a12 APN 10 22665235 missense probably damaging 1.00
IGL03412:Slc2a12 APN 10 22664969 missense probably damaging 1.00
R0537:Slc2a12 UTSW 10 22665068 missense probably damaging 1.00
R0539:Slc2a12 UTSW 10 22692230 missense probably benign 0.04
R0744:Slc2a12 UTSW 10 22702016 unclassified probably benign
R0833:Slc2a12 UTSW 10 22702016 unclassified probably benign
R1056:Slc2a12 UTSW 10 22665451 missense probably benign 0.05
R1926:Slc2a12 UTSW 10 22665242 missense probably damaging 1.00
R2188:Slc2a12 UTSW 10 22664837 missense probably benign 0.01
R2471:Slc2a12 UTSW 10 22664807 missense probably damaging 1.00
R4212:Slc2a12 UTSW 10 22702094 missense probably benign 0.02
R4213:Slc2a12 UTSW 10 22702094 missense probably benign 0.02
R4543:Slc2a12 UTSW 10 22664786 missense probably damaging 1.00
R5203:Slc2a12 UTSW 10 22645314 critical splice donor site probably null
R5203:Slc2a12 UTSW 10 22692218 missense probably benign
R5223:Slc2a12 UTSW 10 22702032 missense probably damaging 0.99
R5500:Slc2a12 UTSW 10 22665137 missense probably damaging 1.00
R6119:Slc2a12 UTSW 10 22665347 missense probably damaging 1.00
R6149:Slc2a12 UTSW 10 22664502 missense probably benign 0.05
R6281:Slc2a12 UTSW 10 22665320 missense probably damaging 1.00
R6330:Slc2a12 UTSW 10 22664995 missense probably benign 0.00
R6385:Slc2a12 UTSW 10 22694030 missense possibly damaging 0.69
R6623:Slc2a12 UTSW 10 22664900 missense probably damaging 1.00
R6895:Slc2a12 UTSW 10 22692185 missense probably damaging 1.00
R7080:Slc2a12 UTSW 10 22665317 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- TGGGCATTGTGAACCTCAAC -3'
(R):5'- TGACAGGCAGTACAGAACAATC -3'

Sequencing Primer
(F):5'- GCATTGTGAACCTCAACATCAATATG -3'
(R):5'- TACAGAACAATCAGAAGTGATAGAGC -3'
Posted On2019-05-15