Incidental Mutation 'R7152:Ltn1'
ID554222
Institutional Source Beutler Lab
Gene Symbol Ltn1
Ensembl Gene ENSMUSG00000052299
Gene Namelisterin E3 ubiquitin protein ligase 1
Synonyms4930528H02Rik, Rnf160, Zfp294, Listerin
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7152 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location87376651-87432612 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87427641 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 65 (F65S)
Ref Sequence ENSEMBL: ENSMUSP00000038775 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039449] [ENSMUST00000232095]
Predicted Effect probably damaging
Transcript: ENSMUST00000039449
AA Change: F65S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038775
Gene: ENSMUSG00000052299
AA Change: F65S

DomainStartEndE-ValueType
low complexity region 160 176 N/A INTRINSIC
low complexity region 400 410 N/A INTRINSIC
low complexity region 509 522 N/A INTRINSIC
low complexity region 553 569 N/A INTRINSIC
low complexity region 815 832 N/A INTRINSIC
low complexity region 1380 1392 N/A INTRINSIC
low complexity region 1427 1451 N/A INTRINSIC
RING 1716 1762 1.05e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000232095
AA Change: F65S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.302 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Like most RING finger proteins, LTN1 functions as an E3 ubiquitin ligase (Chu et al., 2009 [PubMed 19196968]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a gene trap allele display embryonic lethality. Mice homozygous for a point mutation display progressive neuron degeneration and age dependent motor deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
BC067074 T C 13: 113,318,850 F477L Het
Btnl10 A G 11: 58,922,397 N284S probably benign Het
Casz1 C G 4: 148,901,291 probably benign Het
Cdkn2c A T 4: 109,665,038 F37I probably damaging Het
Cdyl2 T C 8: 116,624,327 K22E probably damaging Het
Cers1 T C 8: 70,318,251 W104R probably damaging Het
Cgrrf1 T A 14: 46,853,477 Y223* probably null Het
Cited2 C A 10: 17,724,386 N147K probably benign Het
Clip2 A T 5: 134,496,241 L904Q probably damaging Het
Cntln T C 4: 84,884,700 V79A possibly damaging Het
Cntnap1 C T 11: 101,177,326 R55W probably damaging Het
Ctnna2 T A 6: 76,980,824 T481S possibly damaging Het
Ddx17 T C 15: 79,530,263 T570A possibly damaging Het
Epha7 A G 4: 28,935,826 K483E possibly damaging Het
Eps8l2 A T 7: 141,355,765 I150F possibly damaging Het
Esyt1 A G 10: 128,515,760 S827P possibly damaging Het
Fbxl13 T A 5: 21,582,067 I291F possibly damaging Het
Foxd3 A C 4: 99,657,325 H234P probably benign Het
Ggta1 T A 2: 35,402,699 M199L probably benign Het
Hist2h3b A G 3: 96,268,938 D82G probably benign Het
Ighv5-15 T C 12: 113,826,697 E101G probably benign Het
Igkv8-18 T C 6: 70,356,221 L49P probably damaging Het
Itpr1 T C 6: 108,394,407 probably null Het
Klhl36 C T 8: 119,870,214 T218M probably benign Het
March3 A G 18: 56,775,981 V244A probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Ndst3 T A 3: 123,552,656 I642F possibly damaging Het
Neb T C 2: 52,263,545 D2456G probably damaging Het
Nphp1 A G 2: 127,753,979 M522T probably benign Het
Olfr1080 C T 2: 86,553,329 S265N probably benign Het
Olfr639 T A 7: 104,012,019 M228L probably benign Het
Pam T A 1: 97,885,740 M322L probably damaging Het
Pcdhgb1 C A 18: 37,681,801 H448Q probably benign Het
Pcnt T C 10: 76,411,360 probably null Het
Pgm3 A T 9: 86,567,540 D142E probably benign Het
Pomgnt2 C T 9: 121,983,523 G64D probably damaging Het
Sds A T 5: 120,481,651 probably null Het
Sirpb1b G T 3: 15,542,170 Q351K probably benign Het
Slc2a12 T A 10: 22,665,554 M436K probably benign Het
Slc9a5 G A 8: 105,368,393 G872D probably benign Het
Stxbp2 T G 8: 3,632,583 S57R probably benign Het
Sult2a6 T A 7: 14,222,520 D272V probably benign Het
Supt5 A G 7: 28,323,900 M318T probably benign Het
Tdpoz3 T C 3: 93,826,465 V149A probably damaging Het
Tead2 T A 7: 45,220,447 S124T possibly damaging Het
Tssc4 T A 7: 143,070,402 V149D probably damaging Het
Ttn C T 2: 76,853,161 A906T Het
Uspl1 A G 5: 149,187,778 T2A possibly damaging Het
Vmn1r124 G A 7: 21,260,259 P120L probably benign Het
Vmn1r37 T C 6: 66,731,899 Y170H probably benign Het
Vnn3 T A 10: 23,851,615 V11E possibly damaging Het
Zbtb7b C T 3: 89,380,902 R203H probably benign Het
Zfhx3 T C 8: 108,948,207 V1963A possibly damaging Het
Zfp324 C A 7: 12,966,271 A19E probably benign Het
Zfyve26 T C 12: 79,279,114 S784G probably benign Het
Other mutations in Ltn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00328:Ltn1 APN 16 87418490 missense probably benign 0.03
IGL01139:Ltn1 APN 16 87416009 missense probably benign 0.04
IGL01359:Ltn1 APN 16 87405693 splice site probably benign
IGL01503:Ltn1 APN 16 87420807 critical splice donor site probably benign
IGL01529:Ltn1 APN 16 87381471 missense probably benign 0.00
IGL02437:Ltn1 APN 16 87398001 missense probably benign 0.04
IGL02658:Ltn1 APN 16 87415774 missense probably damaging 1.00
IGL02890:Ltn1 APN 16 87409297 splice site probably null
IGL02899:Ltn1 APN 16 87382659 missense probably benign 0.34
IGL02902:Ltn1 APN 16 87379805 missense possibly damaging 0.70
IGL03128:Ltn1 APN 16 87415944 missense probably benign 0.00
IGL03392:Ltn1 APN 16 87425611 missense probably damaging 1.00
IGL03046:Ltn1 UTSW 16 87405621 missense probably benign 0.10
PIT4305001:Ltn1 UTSW 16 87420323 missense probably damaging 1.00
PIT4366001:Ltn1 UTSW 16 87380840 nonsense probably null
R0126:Ltn1 UTSW 16 87425640 missense probably benign 0.00
R0164:Ltn1 UTSW 16 87405519 splice site probably benign
R0165:Ltn1 UTSW 16 87405519 splice site probably benign
R0280:Ltn1 UTSW 16 87397838 missense probably damaging 1.00
R0565:Ltn1 UTSW 16 87416010 missense probably benign 0.01
R0733:Ltn1 UTSW 16 87412507 missense probably benign 0.01
R1034:Ltn1 UTSW 16 87397137 intron probably null
R1252:Ltn1 UTSW 16 87416030 missense probably benign 0.00
R1524:Ltn1 UTSW 16 87381556 missense probably damaging 1.00
R1746:Ltn1 UTSW 16 87411781 missense possibly damaging 0.86
R1826:Ltn1 UTSW 16 87415616 missense probably damaging 1.00
R1831:Ltn1 UTSW 16 87400146 missense possibly damaging 0.94
R1839:Ltn1 UTSW 16 87416264 nonsense probably null
R1860:Ltn1 UTSW 16 87416343 missense probably benign 0.06
R1997:Ltn1 UTSW 16 87381637 missense probably damaging 1.00
R2109:Ltn1 UTSW 16 87415642 missense probably benign 0.03
R2134:Ltn1 UTSW 16 87382713 missense probably damaging 1.00
R2135:Ltn1 UTSW 16 87382713 missense probably damaging 1.00
R2193:Ltn1 UTSW 16 87427647 missense probably damaging 1.00
R2307:Ltn1 UTSW 16 87432424 critical splice donor site probably null
R2376:Ltn1 UTSW 16 87420807 critical splice donor site probably null
R3054:Ltn1 UTSW 16 87404073 missense probably benign 0.32
R3404:Ltn1 UTSW 16 87416215 missense probably damaging 0.98
R3405:Ltn1 UTSW 16 87416215 missense probably damaging 0.98
R3618:Ltn1 UTSW 16 87420899 missense probably damaging 1.00
R4065:Ltn1 UTSW 16 87416230 missense possibly damaging 0.84
R4066:Ltn1 UTSW 16 87416230 missense possibly damaging 0.84
R4067:Ltn1 UTSW 16 87416230 missense possibly damaging 0.84
R4288:Ltn1 UTSW 16 87397988 missense possibly damaging 0.57
R4436:Ltn1 UTSW 16 87405614 missense probably benign 0.17
R4535:Ltn1 UTSW 16 87426286 missense probably damaging 1.00
R4581:Ltn1 UTSW 16 87402024 critical splice donor site probably null
R4669:Ltn1 UTSW 16 87418487 missense possibly damaging 0.90
R4715:Ltn1 UTSW 16 87418494 missense probably damaging 0.98
R4830:Ltn1 UTSW 16 87379694 missense probably damaging 1.00
R4887:Ltn1 UTSW 16 87398809 nonsense probably null
R4961:Ltn1 UTSW 16 87397791 missense probably benign
R4992:Ltn1 UTSW 16 87405587 missense possibly damaging 0.70
R5073:Ltn1 UTSW 16 87427740 missense probably damaging 0.99
R5288:Ltn1 UTSW 16 87416011 missense possibly damaging 0.80
R5802:Ltn1 UTSW 16 87415681 missense probably benign 0.17
R5907:Ltn1 UTSW 16 87381503 missense possibly damaging 0.94
R6180:Ltn1 UTSW 16 87427789 missense probably damaging 1.00
R6194:Ltn1 UTSW 16 87415810 missense probably damaging 1.00
R6257:Ltn1 UTSW 16 87411774 missense possibly damaging 0.74
R6301:Ltn1 UTSW 16 87420306 missense probably benign
R6481:Ltn1 UTSW 16 87378980 missense probably damaging 1.00
R6525:Ltn1 UTSW 16 87420186 missense probably damaging 1.00
R6958:Ltn1 UTSW 16 87397791 missense probably benign
R6969:Ltn1 UTSW 16 87415690 missense probably damaging 1.00
R7002:Ltn1 UTSW 16 87423473 missense probably benign
R7038:Ltn1 UTSW 16 87424871 missense probably damaging 1.00
R7062:Ltn1 UTSW 16 87427603 missense probably damaging 0.98
R7180:Ltn1 UTSW 16 87418494 missense probably damaging 0.98
R7247:Ltn1 UTSW 16 87409387 missense probably benign 0.00
R7454:Ltn1 UTSW 16 87397812 missense probably benign 0.03
R7471:Ltn1 UTSW 16 87397899 missense probably benign
R7511:Ltn1 UTSW 16 87408828 missense possibly damaging 0.63
X0028:Ltn1 UTSW 16 87402134 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCCCTATCGTGAATATATGATCATGTG -3'
(R):5'- GTCAAACTACTTGGTTCAAAACAGAGC -3'

Sequencing Primer
(F):5'- GTGGTTCAAAATGTTTCAGAGCAAC -3'
(R):5'- CTTGGTTCAAAACAGAGCATTATCTC -3'
Posted On2019-05-15