Incidental Mutation 'R7153:Timm10b'
ID554257
Institutional Source Beutler Lab
Gene Symbol Timm10b
Ensembl Gene ENSMUSG00000089847
Gene Nametranslocase of inner mitochondrial membrane 10B
SynonymsFxC1, Fracture Callus 1, Tim9b, Tim10b
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R7153 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location105640056-105643637 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105640880 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 50 (Q50R)
Ref Sequence ENSEMBL: ENSMUSP00000147436 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033171] [ENSMUST00000058333] [ENSMUST00000084782] [ENSMUST00000106780] [ENSMUST00000106783] [ENSMUST00000106784] [ENSMUST00000106785] [ENSMUST00000106786] [ENSMUST00000131446] [ENSMUST00000133519] [ENSMUST00000137931] [ENSMUST00000140577] [ENSMUST00000142363] [ENSMUST00000142874] [ENSMUST00000149819] [ENSMUST00000150479] [ENSMUST00000151193] [ENSMUST00000157028] [ENSMUST00000209445] [ENSMUST00000209550] [ENSMUST00000209588] [ENSMUST00000210312] [ENSMUST00000210350] [ENSMUST00000210911] [ENSMUST00000211054]
Predicted Effect probably benign
Transcript: ENSMUST00000033171
SMART Domains Protein: ENSMUSP00000033171
Gene: ENSMUSG00000030881

DomainStartEndE-ValueType
low complexity region 52 61 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058333
SMART Domains Protein: ENSMUSP00000057061
Gene: ENSMUSG00000089847

DomainStartEndE-ValueType
Pfam:zf-Tim10_DDP 2 67 8.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084782
SMART Domains Protein: ENSMUSP00000081840
Gene: ENSMUSG00000030881

DomainStartEndE-ValueType
low complexity region 52 61 N/A INTRINSIC
low complexity region 65 81 N/A INTRINSIC
Arfaptin 89 316 1.72e-123 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106780
SMART Domains Protein: ENSMUSP00000102392
Gene: ENSMUSG00000089847

DomainStartEndE-ValueType
Pfam:zf-Tim10_DDP 2 67 8.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106783
SMART Domains Protein: ENSMUSP00000102395
Gene: ENSMUSG00000089847

DomainStartEndE-ValueType
Pfam:zf-Tim10_DDP 2 67 8.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106784
Predicted Effect probably benign
Transcript: ENSMUST00000106785
SMART Domains Protein: ENSMUSP00000102397
Gene: ENSMUSG00000110234

DomainStartEndE-ValueType
Pfam:zf-Tim10_DDP 2 67 3.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106786
SMART Domains Protein: ENSMUSP00000102398
Gene: ENSMUSG00000110234

DomainStartEndE-ValueType
Pfam:zf-Tim10_DDP 3 66 3.6e-18 PFAM
low complexity region 89 107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131446
SMART Domains Protein: ENSMUSP00000120387
Gene: ENSMUSG00000030881

DomainStartEndE-ValueType
low complexity region 52 61 N/A INTRINSIC
low complexity region 65 81 N/A INTRINSIC
Arfaptin 89 316 1.72e-123 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133519
SMART Domains Protein: ENSMUSP00000121649
Gene: ENSMUSG00000030881

DomainStartEndE-ValueType
low complexity region 52 61 N/A INTRINSIC
low complexity region 65 81 N/A INTRINSIC
Arfaptin 89 209 5.49e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137931
SMART Domains Protein: ENSMUSP00000118616
Gene: ENSMUSG00000030881

DomainStartEndE-ValueType
low complexity region 52 61 N/A INTRINSIC
low complexity region 65 81 N/A INTRINSIC
Pfam:Arfaptin 89 153 1.1e-11 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000140577
AA Change: Q50R
Predicted Effect probably benign
Transcript: ENSMUST00000142363
Predicted Effect probably benign
Transcript: ENSMUST00000142874
Predicted Effect probably benign
Transcript: ENSMUST00000149819
Predicted Effect probably benign
Transcript: ENSMUST00000150479
Predicted Effect unknown
Transcript: ENSMUST00000151193
AA Change: Q50R
Predicted Effect probably benign
Transcript: ENSMUST00000157028
Predicted Effect probably benign
Transcript: ENSMUST00000209445
Predicted Effect probably benign
Transcript: ENSMUST00000209550
Predicted Effect probably benign
Transcript: ENSMUST00000209588
Predicted Effect probably benign
Transcript: ENSMUST00000209870
Predicted Effect probably benign
Transcript: ENSMUST00000210312
Predicted Effect probably benign
Transcript: ENSMUST00000210350
Predicted Effect probably benign
Transcript: ENSMUST00000210893
Predicted Effect probably benign
Transcript: ENSMUST00000210911
Predicted Effect probably benign
Transcript: ENSMUST00000211054
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] FXC1, or TIMM10B, belongs to a family of evolutionarily conserved proteins that are organized in heterooligomeric complexes in the mitochondrial intermembrane space. These proteins mediate the import and insertion of hydrophobic membrane proteins into the mitochondrial inner membrane.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano2 A G 6: 125,992,943 T741A possibly damaging Het
Aox4 T C 1: 58,250,219 M767T probably damaging Het
Arhgap39 C A 15: 76,765,491 S27I probably benign Het
AU018091 T A 7: 3,159,513 M296L probably benign Het
Axin1 A G 17: 26,187,968 T512A probably benign Het
B4galnt3 A T 6: 120,214,968 D602E probably benign Het
Bcl6 G A 16: 23,966,226 R675* probably null Het
Bsnd A T 4: 106,492,033 D3E probably benign Het
Btbd18 C T 2: 84,666,428 R137* probably null Het
C2cd5 A G 6: 143,019,409 S871P probably benign Het
Cobl G T 11: 12,254,128 P858Q probably damaging Het
Col6a1 C T 10: 76,710,341 probably null Het
Crb2 A T 2: 37,787,408 H304L probably benign Het
Crybg1 T A 10: 43,964,666 Y1812F possibly damaging Het
Ddx60 A T 8: 61,988,108 K1070N possibly damaging Het
Defb22 T C 2: 152,485,920 K115R unknown Het
Dhx8 C T 11: 101,740,175 probably null Het
Dnah5 T A 15: 28,365,522 probably null Het
Dnah7b T A 1: 46,126,804 F543Y probably benign Het
Ehhadh A G 16: 21,766,321 F270S probably damaging Het
Esyt2 A G 12: 116,346,508 M397V probably benign Het
Fanca A T 8: 123,316,425 L74H probably damaging Het
Fbxl17 C A 17: 63,060,351 V676F probably benign Het
Fndc1 A G 17: 7,801,645 V102A probably damaging Het
Gpalpp1 T C 14: 76,095,011 Y273C probably damaging Het
Gpatch8 TTCCTCCTCCTCCTCTTCCTCCTCCTC TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC 11: 102,480,188 probably benign Het
Grik2 T C 10: 49,535,367 H225R probably benign Het
Helz2 A T 2: 181,231,285 S2411T probably benign Het
Hnmt C T 2: 24,014,341 A103T probably damaging Het
Ighv15-2 G T 12: 114,564,590 Y114* probably null Het
Irak2 A G 6: 113,678,709 H357R probably benign Het
Kcp T C 6: 29,499,015 E320G probably damaging Het
Kpna4 A G 3: 69,089,798 L352S probably damaging Het
Krt36 G A 11: 100,105,146 Q151* probably null Het
Krt77 G A 15: 101,865,496 T241M probably benign Het
Lca5l T A 16: 96,173,809 N305I probably damaging Het
Lefty1 T A 1: 180,937,767 L300Q probably benign Het
Mertk A G 2: 128,736,649 Y185C probably damaging Het
Mmp14 T C 14: 54,436,251 I124T possibly damaging Het
Nlrc4 T C 17: 74,447,103 E95G possibly damaging Het
Npc1 A G 18: 12,213,291 F283L possibly damaging Het
Olfr1180 A C 2: 88,412,118 L180W probably damaging Het
Olfr1282 A T 2: 111,335,901 M59K probably damaging Het
Pcdha11 T C 18: 37,011,225 V123A probably damaging Het
Pcdhga2 T C 18: 37,669,208 V35A probably damaging Het
Pgd G T 4: 149,161,678 T94K probably benign Het
Pik3c2a T C 7: 116,342,252 N1593S probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Plcb3 A G 19: 6,958,084 probably null Het
Prkd3 C T 17: 78,966,355 D491N probably benign Het
Ptprf T C 4: 118,231,543 T688A probably damaging Het
Pycr2 T A 1: 180,906,682 L210M probably damaging Het
Rpl36 T C 17: 56,614,137 I81T probably benign Het
Rraga C T 4: 86,576,016 A33V probably damaging Het
Slc29a1 G A 17: 45,585,762 A429V probably damaging Het
Stab1 T G 14: 31,160,584 E432A probably benign Het
Synj1 C T 16: 90,948,090 G1189R probably benign Het
Synpo2 A G 3: 123,112,404 *1088Q probably null Het
Tbc1d21 T C 9: 58,363,093 D133G probably damaging Het
Tenm2 A G 11: 36,024,182 V2176A probably damaging Het
Tff1 A G 17: 31,162,798 I35T probably benign Het
Thnsl1 T C 2: 21,212,953 V506A possibly damaging Het
Tjp2 A T 19: 24,101,981 N843K probably benign Het
Tle1 A T 4: 72,139,061 F101I probably benign Het
Tmem225 T C 9: 40,148,368 F15L probably benign Het
Trav12-3 T C 14: 53,622,161 L88P probably benign Het
Ttc7b A T 12: 100,355,034 W613R probably damaging Het
Ttn T A 2: 76,778,504 M17723L probably benign Het
Ttn T C 2: 76,945,316 D1840G unknown Het
Tubgcp2 T C 7: 140,001,036 H668R probably benign Het
Ush2a C A 1: 188,728,484 N2647K possibly damaging Het
Vmn1r14 C T 6: 57,233,866 S143F probably benign Het
Vmn2r70 A G 7: 85,565,054 S297P probably damaging Het
Ywhab T C 2: 164,014,060 F119L probably damaging Het
Zmym2 T A 14: 56,950,202 D1108E probably benign Het
Other mutations in Timm10b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Timm10b APN 7 105641138 nonsense probably null
IGL02642:Timm10b APN 7 105668438 splice site probably benign
IGL02689:Timm10b APN 7 105640632 splice site probably benign
R0413:Timm10b UTSW 7 105678330 missense probably benign 0.11
R0635:Timm10b UTSW 7 105640688 intron probably benign
R1761:Timm10b UTSW 7 105683708 nonsense probably null
R4525:Timm10b UTSW 7 105682806 missense probably benign 0.00
R4527:Timm10b UTSW 7 105682806 missense probably benign 0.00
R4528:Timm10b UTSW 7 105682806 missense probably benign 0.00
R4839:Timm10b UTSW 7 105684012 missense probably damaging 1.00
R5007:Timm10b UTSW 7 105641091 missense probably damaging 1.00
R5313:Timm10b UTSW 7 105641080 missense probably damaging 1.00
R5632:Timm10b UTSW 7 105641122 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGTTTCCAGGGGTACACGC -3'
(R):5'- TGGATGAGTTTCCCAGCACAG -3'

Sequencing Primer
(F):5'- TTCCAGGGGTACACGCAAGAAC -3'
(R):5'- ACAGCTGTGCAGGCAGG -3'
Posted On2019-05-15