Incidental Mutation 'R7153:Pik3c2a'
ID554258
Institutional Source Beutler Lab
Gene Symbol Pik3c2a
Ensembl Gene ENSMUSG00000030660
Gene Namephosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha
SynonymsPI3KC2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7153 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location116337265-116443449 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116342252 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 1593 (N1593S)
Ref Sequence ENSEMBL: ENSMUSP00000126092 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170430] [ENSMUST00000206219]
Predicted Effect probably damaging
Transcript: ENSMUST00000170430
AA Change: N1593S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126092
Gene: ENSMUSG00000030660
AA Change: N1593S

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
low complexity region 361 372 N/A INTRINSIC
PI3K_rbd 410 513 3.08e-38 SMART
PI3K_C2 674 783 2.71e-34 SMART
PI3Ka 860 1047 3.62e-85 SMART
PI3Kc 1134 1396 3.1e-125 SMART
PX 1422 1534 5.68e-30 SMART
C2 1573 1677 3.93e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000206219
AA Change: N1593S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000206385
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is not sensitive to nanomolar levels of the inhibitor wortmanin. This protein was shown to be able to be activated by insulin and may be involved in integrin-dependent signaling. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele show chronic renal failure and a range of renal lesions that precede immune involvement. Mice heterozygous for a kinase-inactivating allele show defects in platelet formation, platelet membrane morphology and dynamics, and an enrichment of barbell proplatelets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano2 A G 6: 125,992,943 T741A possibly damaging Het
Aox4 T C 1: 58,250,219 M767T probably damaging Het
Arhgap39 C A 15: 76,765,491 S27I probably benign Het
AU018091 T A 7: 3,159,513 M296L probably benign Het
Axin1 A G 17: 26,187,968 T512A probably benign Het
B4galnt3 A T 6: 120,214,968 D602E probably benign Het
Bcl6 G A 16: 23,966,226 R675* probably null Het
Bsnd A T 4: 106,492,033 D3E probably benign Het
Btbd18 C T 2: 84,666,428 R137* probably null Het
C2cd5 A G 6: 143,019,409 S871P probably benign Het
Cobl G T 11: 12,254,128 P858Q probably damaging Het
Col6a1 C T 10: 76,710,341 probably null Het
Crb2 A T 2: 37,787,408 H304L probably benign Het
Crybg1 T A 10: 43,964,666 Y1812F possibly damaging Het
Ddx60 A T 8: 61,988,108 K1070N possibly damaging Het
Defb22 T C 2: 152,485,920 K115R unknown Het
Dhx8 C T 11: 101,740,175 probably null Het
Dnah5 T A 15: 28,365,522 probably null Het
Dnah7b T A 1: 46,126,804 F543Y probably benign Het
Ehhadh A G 16: 21,766,321 F270S probably damaging Het
Esyt2 A G 12: 116,346,508 M397V probably benign Het
Fanca A T 8: 123,316,425 L74H probably damaging Het
Fbxl17 C A 17: 63,060,351 V676F probably benign Het
Fndc1 A G 17: 7,801,645 V102A probably damaging Het
Gpalpp1 T C 14: 76,095,011 Y273C probably damaging Het
Gpatch8 TTCCTCCTCCTCCTCTTCCTCCTCCTC TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC 11: 102,480,188 probably benign Het
Grik2 T C 10: 49,535,367 H225R probably benign Het
Helz2 A T 2: 181,231,285 S2411T probably benign Het
Hnmt C T 2: 24,014,341 A103T probably damaging Het
Ighv15-2 G T 12: 114,564,590 Y114* probably null Het
Irak2 A G 6: 113,678,709 H357R probably benign Het
Kcp T C 6: 29,499,015 E320G probably damaging Het
Kpna4 A G 3: 69,089,798 L352S probably damaging Het
Krt36 G A 11: 100,105,146 Q151* probably null Het
Krt77 G A 15: 101,865,496 T241M probably benign Het
Lca5l T A 16: 96,173,809 N305I probably damaging Het
Lefty1 T A 1: 180,937,767 L300Q probably benign Het
Mertk A G 2: 128,736,649 Y185C probably damaging Het
Mmp14 T C 14: 54,436,251 I124T possibly damaging Het
Nlrc4 T C 17: 74,447,103 E95G possibly damaging Het
Npc1 A G 18: 12,213,291 F283L possibly damaging Het
Olfr1180 A C 2: 88,412,118 L180W probably damaging Het
Olfr1282 A T 2: 111,335,901 M59K probably damaging Het
Pcdha11 T C 18: 37,011,225 V123A probably damaging Het
Pcdhga2 T C 18: 37,669,208 V35A probably damaging Het
Pgd G T 4: 149,161,678 T94K probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Plcb3 A G 19: 6,958,084 probably null Het
Prkd3 C T 17: 78,966,355 D491N probably benign Het
Ptprf T C 4: 118,231,543 T688A probably damaging Het
Pycr2 T A 1: 180,906,682 L210M probably damaging Het
Rpl36 T C 17: 56,614,137 I81T probably benign Het
Rraga C T 4: 86,576,016 A33V probably damaging Het
Slc29a1 G A 17: 45,585,762 A429V probably damaging Het
Stab1 T G 14: 31,160,584 E432A probably benign Het
Synj1 C T 16: 90,948,090 G1189R probably benign Het
Synpo2 A G 3: 123,112,404 *1088Q probably null Het
Tbc1d21 T C 9: 58,363,093 D133G probably damaging Het
Tenm2 A G 11: 36,024,182 V2176A probably damaging Het
Tff1 A G 17: 31,162,798 I35T probably benign Het
Thnsl1 T C 2: 21,212,953 V506A possibly damaging Het
Timm10b A G 7: 105,640,880 Q50R unknown Het
Tjp2 A T 19: 24,101,981 N843K probably benign Het
Tle1 A T 4: 72,139,061 F101I probably benign Het
Tmem225 T C 9: 40,148,368 F15L probably benign Het
Trav12-3 T C 14: 53,622,161 L88P probably benign Het
Ttc7b A T 12: 100,355,034 W613R probably damaging Het
Ttn T C 2: 76,945,316 D1840G unknown Het
Ttn T A 2: 76,778,504 M17723L probably benign Het
Tubgcp2 T C 7: 140,001,036 H668R probably benign Het
Ush2a C A 1: 188,728,484 N2647K possibly damaging Het
Vmn1r14 C T 6: 57,233,866 S143F probably benign Het
Vmn2r70 A G 7: 85,565,054 S297P probably damaging Het
Ywhab T C 2: 164,014,060 F119L probably damaging Het
Zmym2 T A 14: 56,950,202 D1108E probably benign Het
Other mutations in Pik3c2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Pik3c2a APN 7 116376283 missense possibly damaging 0.50
IGL00732:Pik3c2a APN 7 116364500 missense possibly damaging 0.82
IGL01303:Pik3c2a APN 7 116373803 missense possibly damaging 0.94
IGL01443:Pik3c2a APN 7 116418194 missense probably benign 0.01
IGL01462:Pik3c2a APN 7 116376250 missense possibly damaging 0.94
IGL01641:Pik3c2a APN 7 116350765 intron probably benign
IGL01695:Pik3c2a APN 7 116417518 missense possibly damaging 0.82
IGL02095:Pik3c2a APN 7 116346188 missense probably damaging 1.00
IGL02137:Pik3c2a APN 7 116350804 missense probably benign 0.00
IGL02160:Pik3c2a APN 7 116388064 missense probably damaging 1.00
IGL02224:Pik3c2a APN 7 116363340 splice site probably benign
IGL02345:Pik3c2a APN 7 116405891 missense probably damaging 1.00
IGL02644:Pik3c2a APN 7 116372814 missense probably benign 0.00
IGL02756:Pik3c2a APN 7 116364513 missense probably benign 0.01
IGL03339:Pik3c2a APN 7 116418021 missense possibly damaging 0.57
IGL03412:Pik3c2a APN 7 116417839 missense probably benign 0.21
R0046:Pik3c2a UTSW 7 116354072 missense probably damaging 1.00
R0387:Pik3c2a UTSW 7 116373744 missense probably damaging 1.00
R0501:Pik3c2a UTSW 7 116354055 missense probably damaging 1.00
R0650:Pik3c2a UTSW 7 116346247 splice site probably benign
R0991:Pik3c2a UTSW 7 116362045 critical splice donor site probably null
R1074:Pik3c2a UTSW 7 116350925 nonsense probably null
R1485:Pik3c2a UTSW 7 116417673 missense possibly damaging 0.50
R1495:Pik3c2a UTSW 7 116388065 missense probably benign 0.01
R1510:Pik3c2a UTSW 7 116388045 missense probably benign 0.00
R1654:Pik3c2a UTSW 7 116368848 missense probably benign 0.02
R1711:Pik3c2a UTSW 7 116417927 nonsense probably null
R1733:Pik3c2a UTSW 7 116418520 start codon destroyed possibly damaging 0.96
R1751:Pik3c2a UTSW 7 116346236 missense probably damaging 0.98
R1812:Pik3c2a UTSW 7 116417664 missense probably damaging 0.98
R1817:Pik3c2a UTSW 7 116376512 critical splice donor site probably null
R1826:Pik3c2a UTSW 7 116368117 missense probably benign
R1875:Pik3c2a UTSW 7 116417971 missense probably benign 0.35
R1995:Pik3c2a UTSW 7 116354006 missense probably damaging 1.00
R2007:Pik3c2a UTSW 7 116342237 missense probably damaging 1.00
R2009:Pik3c2a UTSW 7 116364503 missense probably damaging 1.00
R2013:Pik3c2a UTSW 7 116350931 critical splice acceptor site probably null
R2014:Pik3c2a UTSW 7 116350931 critical splice acceptor site probably null
R2015:Pik3c2a UTSW 7 116350931 critical splice acceptor site probably null
R2027:Pik3c2a UTSW 7 116350822 missense probably damaging 1.00
R2050:Pik3c2a UTSW 7 116417451 critical splice donor site probably null
R2068:Pik3c2a UTSW 7 116372891 nonsense probably null
R3814:Pik3c2a UTSW 7 116348179 missense probably damaging 1.00
R3848:Pik3c2a UTSW 7 116364550 nonsense probably null
R4386:Pik3c2a UTSW 7 116354099 missense probably damaging 1.00
R4668:Pik3c2a UTSW 7 116358688 missense probably benign 0.16
R4783:Pik3c2a UTSW 7 116417825 missense probably damaging 1.00
R4860:Pik3c2a UTSW 7 116340156 missense probably damaging 1.00
R4860:Pik3c2a UTSW 7 116340156 missense probably damaging 1.00
R5057:Pik3c2a UTSW 7 116376283 missense possibly damaging 0.50
R5080:Pik3c2a UTSW 7 116348274 missense probably damaging 1.00
R5083:Pik3c2a UTSW 7 116342401 missense probably damaging 1.00
R5144:Pik3c2a UTSW 7 116350786 missense probably benign 0.01
R5589:Pik3c2a UTSW 7 116417658 missense probably benign 0.02
R5646:Pik3c2a UTSW 7 116405951 missense probably damaging 1.00
R5829:Pik3c2a UTSW 7 116372814 missense probably benign 0.00
R5951:Pik3c2a UTSW 7 116368184 missense probably damaging 0.96
R5958:Pik3c2a UTSW 7 116362564 missense probably damaging 1.00
R6356:Pik3c2a UTSW 7 116348205 missense possibly damaging 0.46
R6551:Pik3c2a UTSW 7 116417496 missense probably damaging 0.97
R6641:Pik3c2a UTSW 7 116340225 critical splice acceptor site probably null
R6661:Pik3c2a UTSW 7 116368758 missense possibly damaging 0.77
R6789:Pik3c2a UTSW 7 116362184 missense probably damaging 1.00
R6874:Pik3c2a UTSW 7 116394305 missense probably damaging 1.00
R6985:Pik3c2a UTSW 7 116417988 missense probably damaging 0.98
R7106:Pik3c2a UTSW 7 116418133 nonsense probably null
R7176:Pik3c2a UTSW 7 116388096 missense possibly damaging 0.47
R7265:Pik3c2a UTSW 7 116388086 missense probably damaging 1.00
R7303:Pik3c2a UTSW 7 116405943 missense probably benign 0.00
R7308:Pik3c2a UTSW 7 116373839 missense probably damaging 1.00
R7375:Pik3c2a UTSW 7 116376386 missense probably damaging 1.00
R7406:Pik3c2a UTSW 7 116354007 missense probably damaging 1.00
R7426:Pik3c2a UTSW 7 116372854 missense probably damaging 1.00
R7528:Pik3c2a UTSW 7 116394239 missense not run
R7539:Pik3c2a UTSW 7 116340096 missense not run
Predicted Primers PCR Primer
(F):5'- ATACTGTTCAGCTCACGTGGG -3'
(R):5'- CAGTGAAGTTATCTGTTTCTTACCG -3'

Sequencing Primer
(F):5'- GGGTTCAATTCTCATCAGCTACAGG -3'
(R):5'- GAAATGGCACCCTCTTCATCATGG -3'
Posted On2019-05-15