Incidental Mutation 'R7153:Cobl'
ID554267
Institutional Source Beutler Lab
Gene Symbol Cobl
Ensembl Gene ENSMUSG00000020173
Gene Namecordon-bleu WH2 repeat
SynonymsC530045F18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7153 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location12236608-12464960 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 12254128 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 858 (P858Q)
Ref Sequence ENSEMBL: ENSMUSP00000045693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046755] [ENSMUST00000109650] [ENSMUST00000109651] [ENSMUST00000172919] [ENSMUST00000172956] [ENSMUST00000174874]
PDB Structure
Actin complex with Gelsolin Segment 1 fused to Cobl segment [X-RAY DIFFRACTION]
Crystal Structure of an Actin Dimer in Complex with the Actin Nucleator Cordon-Bleu [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000046755
AA Change: P858Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045693
Gene: ENSMUSG00000020173
AA Change: P858Q

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
Pfam:Cobl 144 235 2.2e-46 PFAM
low complexity region 328 333 N/A INTRINSIC
low complexity region 360 376 N/A INTRINSIC
low complexity region 408 433 N/A INTRINSIC
low complexity region 468 482 N/A INTRINSIC
low complexity region 526 541 N/A INTRINSIC
coiled coil region 564 589 N/A INTRINSIC
WH2 1185 1205 1.32e0 SMART
WH2 1225 1245 6.36e-3 SMART
low complexity region 1276 1296 N/A INTRINSIC
WH2 1313 1333 3.91e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109650
AA Change: P776Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105277
Gene: ENSMUSG00000020173
AA Change: P776Q

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
Pfam:Cobl 182 260 1.6e-40 PFAM
low complexity region 303 308 N/A INTRINSIC
low complexity region 335 351 N/A INTRINSIC
low complexity region 386 400 N/A INTRINSIC
low complexity region 444 459 N/A INTRINSIC
coiled coil region 482 507 N/A INTRINSIC
WH2 1103 1123 1.32e0 SMART
WH2 1143 1163 6.36e-3 SMART
low complexity region 1194 1214 N/A INTRINSIC
WH2 1231 1251 3.91e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109651
AA Change: P833Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105278
Gene: ENSMUSG00000020173
AA Change: P833Q

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
Pfam:Cobl 182 260 1.2e-40 PFAM
low complexity region 303 308 N/A INTRINSIC
low complexity region 335 351 N/A INTRINSIC
low complexity region 383 408 N/A INTRINSIC
low complexity region 443 457 N/A INTRINSIC
low complexity region 501 516 N/A INTRINSIC
coiled coil region 539 564 N/A INTRINSIC
WH2 1160 1180 1.32e0 SMART
WH2 1200 1220 6.36e-3 SMART
low complexity region 1251 1271 N/A INTRINSIC
WH2 1288 1308 3.91e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172919
SMART Domains Protein: ENSMUSP00000133669
Gene: ENSMUSG00000020173

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
Pfam:Cobl 182 260 2.6e-41 PFAM
low complexity region 328 333 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172956
SMART Domains Protein: ENSMUSP00000134372
Gene: ENSMUSG00000020173

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
Pfam:Cobl 182 260 2.4e-41 PFAM
low complexity region 303 308 N/A INTRINSIC
low complexity region 335 351 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174874
AA Change: P851Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133470
Gene: ENSMUSG00000020173
AA Change: P851Q

DomainStartEndE-ValueType
low complexity region 6 23 N/A INTRINSIC
Pfam:Cobl 175 253 1.2e-40 PFAM
low complexity region 321 326 N/A INTRINSIC
low complexity region 353 369 N/A INTRINSIC
low complexity region 401 426 N/A INTRINSIC
low complexity region 461 475 N/A INTRINSIC
low complexity region 519 534 N/A INTRINSIC
coiled coil region 557 582 N/A INTRINSIC
WH2 1178 1198 1.32e0 SMART
WH2 1218 1238 6.36e-3 SMART
low complexity region 1269 1289 N/A INTRINSIC
WH2 1306 1326 3.91e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains WH2 domains (WASP, Wiskott-Aldrich syndrome protein, homology domain-2) that interact with actin. The encoded actin regulator protein is required for growth and assembly of brush border microvilli that play a role in maintaining intestinal homeostasis. A similar protein in mouse functions in midbrain neural tube closure. A pseudogene of this gene is located on chromosome X. [provided by RefSeq, Oct 2016]
PHENOTYPE: Animals homozygous for this mutation do not display a phenotype. However, the allele exacerbates the neural tube defects seen in the loop tail mouse. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano2 A G 6: 125,992,943 T741A possibly damaging Het
Aox4 T C 1: 58,250,219 M767T probably damaging Het
Arhgap39 C A 15: 76,765,491 S27I probably benign Het
AU018091 T A 7: 3,159,513 M296L probably benign Het
Axin1 A G 17: 26,187,968 T512A probably benign Het
B4galnt3 A T 6: 120,214,968 D602E probably benign Het
Bcl6 G A 16: 23,966,226 R675* probably null Het
Bsnd A T 4: 106,492,033 D3E probably benign Het
Btbd18 C T 2: 84,666,428 R137* probably null Het
C2cd5 A G 6: 143,019,409 S871P probably benign Het
Col6a1 C T 10: 76,710,341 probably null Het
Crb2 A T 2: 37,787,408 H304L probably benign Het
Crybg1 T A 10: 43,964,666 Y1812F possibly damaging Het
Ddx60 A T 8: 61,988,108 K1070N possibly damaging Het
Defb22 T C 2: 152,485,920 K115R unknown Het
Dhx8 C T 11: 101,740,175 probably null Het
Dnah5 T A 15: 28,365,522 probably null Het
Dnah7b T A 1: 46,126,804 F543Y probably benign Het
Ehhadh A G 16: 21,766,321 F270S probably damaging Het
Esyt2 A G 12: 116,346,508 M397V probably benign Het
Fanca A T 8: 123,316,425 L74H probably damaging Het
Fbxl17 C A 17: 63,060,351 V676F probably benign Het
Fndc1 A G 17: 7,801,645 V102A probably damaging Het
Gpalpp1 T C 14: 76,095,011 Y273C probably damaging Het
Gpatch8 TTCCTCCTCCTCCTCTTCCTCCTCCTC TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC 11: 102,480,188 probably benign Het
Grik2 T C 10: 49,535,367 H225R probably benign Het
Helz2 A T 2: 181,231,285 S2411T probably benign Het
Hnmt C T 2: 24,014,341 A103T probably damaging Het
Ighv15-2 G T 12: 114,564,590 Y114* probably null Het
Irak2 A G 6: 113,678,709 H357R probably benign Het
Kcp T C 6: 29,499,015 E320G probably damaging Het
Kpna4 A G 3: 69,089,798 L352S probably damaging Het
Krt36 G A 11: 100,105,146 Q151* probably null Het
Krt77 G A 15: 101,865,496 T241M probably benign Het
Lca5l T A 16: 96,173,809 N305I probably damaging Het
Lefty1 T A 1: 180,937,767 L300Q probably benign Het
Mertk A G 2: 128,736,649 Y185C probably damaging Het
Mmp14 T C 14: 54,436,251 I124T possibly damaging Het
Nlrc4 T C 17: 74,447,103 E95G possibly damaging Het
Npc1 A G 18: 12,213,291 F283L possibly damaging Het
Olfr1180 A C 2: 88,412,118 L180W probably damaging Het
Olfr1282 A T 2: 111,335,901 M59K probably damaging Het
Pcdha11 T C 18: 37,011,225 V123A probably damaging Het
Pcdhga2 T C 18: 37,669,208 V35A probably damaging Het
Pgd G T 4: 149,161,678 T94K probably benign Het
Pik3c2a T C 7: 116,342,252 N1593S probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Plcb3 A G 19: 6,958,084 probably null Het
Prkd3 C T 17: 78,966,355 D491N probably benign Het
Ptprf T C 4: 118,231,543 T688A probably damaging Het
Pycr2 T A 1: 180,906,682 L210M probably damaging Het
Rpl36 T C 17: 56,614,137 I81T probably benign Het
Rraga C T 4: 86,576,016 A33V probably damaging Het
Slc29a1 G A 17: 45,585,762 A429V probably damaging Het
Stab1 T G 14: 31,160,584 E432A probably benign Het
Synj1 C T 16: 90,948,090 G1189R probably benign Het
Synpo2 A G 3: 123,112,404 *1088Q probably null Het
Tbc1d21 T C 9: 58,363,093 D133G probably damaging Het
Tenm2 A G 11: 36,024,182 V2176A probably damaging Het
Tff1 A G 17: 31,162,798 I35T probably benign Het
Thnsl1 T C 2: 21,212,953 V506A possibly damaging Het
Timm10b A G 7: 105,640,880 Q50R unknown Het
Tjp2 A T 19: 24,101,981 N843K probably benign Het
Tle1 A T 4: 72,139,061 F101I probably benign Het
Tmem225 T C 9: 40,148,368 F15L probably benign Het
Trav12-3 T C 14: 53,622,161 L88P probably benign Het
Ttc7b A T 12: 100,355,034 W613R probably damaging Het
Ttn T A 2: 76,778,504 M17723L probably benign Het
Ttn T C 2: 76,945,316 D1840G unknown Het
Tubgcp2 T C 7: 140,001,036 H668R probably benign Het
Ush2a C A 1: 188,728,484 N2647K possibly damaging Het
Vmn1r14 C T 6: 57,233,866 S143F probably benign Het
Vmn2r70 A G 7: 85,565,054 S297P probably damaging Het
Ywhab T C 2: 164,014,060 F119L probably damaging Het
Zmym2 T A 14: 56,950,202 D1108E probably benign Het
Other mutations in Cobl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Cobl APN 11 12375813 missense possibly damaging 0.89
IGL00698:Cobl APN 11 12253722 missense probably benign 0.41
IGL00772:Cobl APN 11 12266985 missense probably benign 0.02
IGL00922:Cobl APN 11 12254866 missense probably damaging 1.00
IGL00985:Cobl APN 11 12254843 missense probably damaging 1.00
IGL01641:Cobl APN 11 12309641 nonsense probably null
IGL01722:Cobl APN 11 12253987 missense probably benign 0.00
IGL01734:Cobl APN 11 12254980 splice site probably benign
IGL01924:Cobl APN 11 12254596 missense probably benign 0.30
IGL02105:Cobl APN 11 12249651 missense probably damaging 1.00
IGL02326:Cobl APN 11 12386712 missense possibly damaging 0.69
IGL02342:Cobl APN 11 12253672 missense possibly damaging 0.64
IGL02426:Cobl APN 11 12254351 nonsense probably null
IGL02754:Cobl APN 11 12254371 missense probably damaging 1.00
IGL02754:Cobl APN 11 12254370 missense probably damaging 1.00
IGL02811:Cobl APN 11 12253285 missense possibly damaging 0.56
IGL02859:Cobl APN 11 12369602 missense probably damaging 1.00
IGL02999:Cobl APN 11 12343869 missense possibly damaging 0.71
IGL03030:Cobl APN 11 12254241 missense possibly damaging 0.80
IGL03191:Cobl APN 11 12253364 missense probably benign 0.00
PIT4418001:Cobl UTSW 11 12256240 missense possibly damaging 0.79
PIT4480001:Cobl UTSW 11 12253592 missense probably benign
PIT4495001:Cobl UTSW 11 12254596 missense probably benign 0.00
R0031:Cobl UTSW 11 12254945 missense probably benign 0.36
R0241:Cobl UTSW 11 12254524 missense probably benign 0.25
R0241:Cobl UTSW 11 12254524 missense probably benign 0.25
R0322:Cobl UTSW 11 12267072 missense probably damaging 1.00
R0597:Cobl UTSW 11 12254699 missense probably benign 0.24
R0733:Cobl UTSW 11 12365167 missense probably benign 0.31
R0734:Cobl UTSW 11 12375971 missense probably damaging 1.00
R0784:Cobl UTSW 11 12266843 splice site probably benign
R0884:Cobl UTSW 11 12375908 missense possibly damaging 0.89
R1065:Cobl UTSW 11 12254327 missense possibly damaging 0.67
R1331:Cobl UTSW 11 12375853 missense probably damaging 0.96
R1892:Cobl UTSW 11 12253258 missense probably damaging 0.99
R2847:Cobl UTSW 11 12378342 missense probably damaging 1.00
R2848:Cobl UTSW 11 12378342 missense probably damaging 1.00
R3407:Cobl UTSW 11 12375830 missense probably damaging 1.00
R4627:Cobl UTSW 11 12251093 missense probably damaging 1.00
R4662:Cobl UTSW 11 12253672 missense probably benign 0.08
R4677:Cobl UTSW 11 12386665 missense possibly damaging 0.93
R4844:Cobl UTSW 11 12254740 missense probably benign 0.10
R4942:Cobl UTSW 11 12254185 missense probably damaging 0.99
R5158:Cobl UTSW 11 12256198 missense possibly damaging 0.84
R5195:Cobl UTSW 11 12253565 missense probably benign 0.02
R5255:Cobl UTSW 11 12375825 missense probably damaging 1.00
R5588:Cobl UTSW 11 12343886 nonsense probably null
R5637:Cobl UTSW 11 12296531 intron probably benign
R5643:Cobl UTSW 11 12306948 splice site probably benign
R5749:Cobl UTSW 11 12266965 missense possibly damaging 0.86
R5953:Cobl UTSW 11 12256220 missense probably benign 0.00
R6000:Cobl UTSW 11 12369684 missense probably benign 0.08
R6373:Cobl UTSW 11 12253118 missense probably damaging 1.00
R7034:Cobl UTSW 11 12254177 missense probably damaging 1.00
R7071:Cobl UTSW 11 12254795 missense probably benign 0.00
R7077:Cobl UTSW 11 12253441 missense probably benign 0.04
R7078:Cobl UTSW 11 12378271 missense probably damaging 1.00
R7099:Cobl UTSW 11 12296540 missense
R7448:Cobl UTSW 11 12256225 missense possibly damaging 0.46
R7519:Cobl UTSW 11 12253124 missense probably damaging 1.00
Predicted Primers
Posted On2019-05-15