Incidental Mutation 'R6919:Il17rb'
ID554324
Institutional Source Beutler Lab
Gene Symbol Il17rb
Ensembl Gene ENSMUSG00000015966
Gene Nameinterleukin 17 receptor B
SynonymsIL17RH1, Evi27, IL-17Rh1, IL-17ER, Il17br
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R6919 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location29996135-30008896 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to G at 30004271 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016110] [ENSMUST00000067620] [ENSMUST00000122205] [ENSMUST00000135888] [ENSMUST00000136726] [ENSMUST00000224797]
Predicted Effect probably null
Transcript: ENSMUST00000016110
SMART Domains Protein: ENSMUSP00000016110
Gene: ENSMUSG00000015966

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:IL17R_fnIII_D1 22 175 4.3e-26 PFAM
Pfam:IL17R_fnIII_D2 176 268 1.3e-11 PFAM
transmembrane domain 287 309 N/A INTRINSIC
Pfam:SEFIR 329 476 3.5e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000067620
SMART Domains Protein: ENSMUSP00000065542
Gene: ENSMUSG00000015970

DomainStartEndE-ValueType
Pfam:GMC_oxred_N 43 341 2.4e-98 PFAM
Pfam:Lycopene_cycl 45 110 8.4e-8 PFAM
Pfam:GMC_oxred_C 431 569 2.5e-43 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000122205
SMART Domains Protein: ENSMUSP00000113686
Gene: ENSMUSG00000015966

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
PDB:4HSA|F 34 276 2e-23 PDB
transmembrane domain 287 309 N/A INTRINSIC
Pfam:SEFIR 329 476 1.7e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135888
SMART Domains Protein: ENSMUSP00000121407
Gene: ENSMUSG00000015966

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:IL17R_fnIII_D1 22 123 1.1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136726
SMART Domains Protein: ENSMUSP00000117802
Gene: ENSMUSG00000015966

DomainStartEndE-ValueType
PDB:3JVF|C 13 171 5e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000224797
Meta Mutation Damage Score 0.6632 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine receptor. This receptor specifically binds to IL17B and IL17E, but does not bind to IL17 and IL17C. This receptor has been shown to mediate the activation of NF-kappaB and the production of IL8 induced by IL17E. The expression of the rat counterpart of this gene was found to be significantly up-regulated during intestinal inflammation, which suggested the immunoregulatory activity of this receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that are homozygous for a null allele have defects in their response to IL17A or IL17F. In addition this locus is a common site of retoviral integration in BXH2 murine myeloid leukemias and occurred at a CpG island 6 kb upstream of the Il17rb gene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A G 11: 65,152,530 probably benign Het
4931408C20Rik T C 1: 26,682,934 Y1055C probably benign Het
6430548M08Rik T C 8: 120,145,482 S50P probably damaging Het
Aacs A G 5: 125,506,163 D261G probably benign Het
Abcc4 T A 14: 118,594,894 T775S probably benign Het
Acsl6 A G 11: 54,341,756 probably null Het
Agbl5 T A 5: 30,904,717 F196I probably benign Het
Ahnak2 T C 12: 112,774,684 T985A possibly damaging Het
Ak1 A T 2: 32,631,122 D101V possibly damaging Het
Alx1 A G 10: 103,025,200 Y156H probably damaging Het
Angptl7 T A 4: 148,500,031 S87C probably benign Het
Ankrd36 A G 11: 5,629,299 T188A probably benign Het
Arhgap11a A C 2: 113,839,709 S356R possibly damaging Het
Ascc3 G T 10: 50,645,753 E455* probably null Het
Atp6v0a2 G A 5: 124,712,161 probably null Het
B3gnt7 T C 1: 86,305,694 W104R probably damaging Het
Bbs9 G A 9: 22,812,544 probably null Het
Cc2d2a T A 5: 43,703,215 D544E probably benign Het
Cic C T 7: 25,271,777 T311I probably benign Het
Cngb1 T A 8: 95,248,375 R1157W probably null Het
Cntln A G 4: 85,115,368 H1310R probably benign Het
Cntnap5c A T 17: 58,293,953 I764F probably benign Het
Col26a1 T C 5: 136,744,234 Q362R possibly damaging Het
Cyp2c29 G A 19: 39,291,141 R100K probably benign Het
D17H6S53E C G 17: 35,127,246 D44E probably damaging Het
Dap3 A G 3: 88,930,989 V65A probably damaging Het
Dna2 A T 10: 62,957,003 I266F probably damaging Het
Dnah14 G A 1: 181,585,066 G57E probably benign Het
Dock9 A T 14: 121,643,152 V333E probably benign Het
Dpm1 A G 2: 168,230,275 Y27H probably damaging Het
Dsp A T 13: 38,167,655 Y150F possibly damaging Het
Emilin3 A T 2: 160,908,098 I577N probably damaging Het
Erap1 A G 13: 74,671,433 T189A probably benign Het
Fam208a T A 14: 27,449,801 L397* probably null Het
Fat2 A G 11: 55,282,771 I2372T possibly damaging Het
Fbn2 A T 18: 58,124,187 probably null Het
Gnl1 A T 17: 35,987,533 R390* probably null Het
Hivep1 A G 13: 42,183,452 I2336V probably benign Het
Itga9 T C 9: 118,887,815 W396R probably damaging Het
Katnal2 A G 18: 77,011,038 V152A probably benign Het
Kcnk3 A G 5: 30,622,400 T265A probably benign Het
Klhl1 T C 14: 96,136,594 Y672C probably benign Het
Leng8 C A 7: 4,143,626 N412K possibly damaging Het
Lrrc9 T A 12: 72,506,393 F1356L probably benign Het
Map7 A G 10: 20,171,082 probably benign Het
Mei1 T C 15: 82,081,930 F251S probably damaging Het
Mia2 A G 12: 59,129,895 E9G possibly damaging Het
Ms4a13 C A 19: 11,171,885 W182C probably benign Het
Muc16 C T 9: 18,660,299 R308K unknown Het
Olfr1195 G A 2: 88,683,684 T16I possibly damaging Het
Olfr936 A G 9: 39,047,531 probably benign Het
Pcnt A G 10: 76,385,798 V1998A probably benign Het
Pgm1 A T 5: 64,097,025 N51I probably benign Het
Piezo1 T A 8: 122,490,281 H1333L probably damaging Het
Prg2 G A 2: 84,983,256 V199M probably damaging Het
Prss51 T C 14: 64,097,488 V182A probably damaging Het
Psmb9 A T 17: 34,183,225 Y132* probably null Het
Ralyl T C 3: 13,777,031 Y76H probably damaging Het
Rnaset2a A T 17: 8,130,282 D174E probably benign Het
Rnft1 G A 11: 86,495,330 probably null Het
Robo2 T C 16: 73,961,867 Y676C probably damaging Het
Samd9l T G 6: 3,376,313 Y316S possibly damaging Het
Siah3 T A 14: 75,456,138 F28Y possibly damaging Het
Slc28a3 C T 13: 58,573,443 probably null Het
Slc8a1 A G 17: 81,388,872 F911S probably damaging Het
Speg T A 1: 75,387,908 L156* probably null Het
Spopl T G 2: 23,517,861 M269L probably benign Het
Tacr1 C T 6: 82,557,073 T360I probably benign Het
Tmem262 A G 19: 6,080,737 E95G probably benign Het
Tmem68 G T 4: 3,569,669 T7N possibly damaging Het
Top3a T A 11: 60,749,493 I460F probably damaging Het
Trafd1 G A 5: 121,384,074 R5* probably null Het
Trim16 T A 11: 62,840,869 V435D possibly damaging Het
Tspan17 A G 13: 54,796,033 D236G probably damaging Het
Tssk2 A T 16: 17,899,701 M323L probably benign Het
Ubqln5 A G 7: 104,129,008 V203A probably benign Het
Utrn A T 10: 12,693,470 L1134* probably null Het
Vmn1r37 C T 6: 66,731,720 S73F possibly damaging Het
Vps13c A G 9: 67,927,452 K1688E probably damaging Het
Zbtb39 A G 10: 127,741,842 D95G probably damaging Het
Zfhx3 T A 8: 108,800,528 I1019N probably damaging Het
Zfp207 C T 11: 80,395,503 probably benign Het
Zmiz1 C T 14: 25,643,638 T169M probably damaging Het
Other mutations in Il17rb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01584:Il17rb APN 14 30003680 missense probably damaging 1.00
IGL03151:Il17rb APN 14 30006853 missense probably benign 0.05
R0276:Il17rb UTSW 14 30004380 missense probably damaging 1.00
R0391:Il17rb UTSW 14 30004347 missense probably benign 0.00
R0391:Il17rb UTSW 14 30006155 unclassified probably null
R0408:Il17rb UTSW 14 29996680 missense probably benign 0.02
R2011:Il17rb UTSW 14 29996840 nonsense probably null
R2012:Il17rb UTSW 14 29996840 nonsense probably null
R2057:Il17rb UTSW 14 29997154 missense probably benign 0.01
R2227:Il17rb UTSW 14 30006081 missense probably benign 0.02
R3548:Il17rb UTSW 14 30008772 unclassified probably null
R4199:Il17rb UTSW 14 29996644 missense probably benign
R4578:Il17rb UTSW 14 30002399 missense probably damaging 0.97
R5092:Il17rb UTSW 14 30002376 missense probably benign 0.00
R5928:Il17rb UTSW 14 30004275 critical splice donor site probably null
R6280:Il17rb UTSW 14 30002971 missense probably benign 0.00
R6378:Il17rb UTSW 14 30000363 missense probably damaging 0.97
R6470:Il17rb UTSW 14 30002909 missense probably benign 0.10
R6741:Il17rb UTSW 14 30000336 missense possibly damaging 0.82
R7133:Il17rb UTSW 14 29996871 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGTGTGGCATTTTAGAGTCAGG -3'
(R):5'- TTGAGTACCTGTGTGAGCCAC -3'

Sequencing Primer
(F):5'- GAGTCAGGGTATAAGTTCAACTCCC -3'
(R):5'- TGTGAGCCACATAAGCACTAATG -3'
Posted On2019-05-30