Incidental Mutation 'R6923:Pcdhb7'
ID554336
Institutional Source Beutler Lab
Gene Symbol Pcdhb7
Ensembl Gene ENSMUSG00000045062
Gene Nameprotocadherin beta 7
SynonymsPcdhb4B, PcdhbG
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R6923 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location37341702-37345202 bp(+) (GRCm38)
Type of Mutationintron (387319 bp from exon)
DNA Base Change (assembly) C to T at 37342469 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000111325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053037] [ENSMUST00000061717] [ENSMUST00000115661] [ENSMUST00000194544]
PDB Structure
Structure of EC1 domain of CNR [SOLUTION NMR]
Predicted Effect silent
Transcript: ENSMUST00000053037
SMART Domains Protein: ENSMUSP00000051041
Gene: ENSMUSG00000045062

DomainStartEndE-ValueType
Pfam:Cadherin_2 61 143 1.4e-32 PFAM
CA 186 271 5.47e-17 SMART
CA 295 376 4.43e-26 SMART
CA 399 480 1.04e-22 SMART
CA 504 590 2.12e-23 SMART
CA 620 701 5.73e-11 SMART
Pfam:Cadherin_C_2 718 801 5.5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061717
SMART Domains Protein: ENSMUSP00000058592
Gene: ENSMUSG00000051678

DomainStartEndE-ValueType
Pfam:Cadherin_2 30 112 2.7e-33 PFAM
CA 155 240 1.48e-22 SMART
CA 264 344 3.02e-28 SMART
CA 367 448 1.69e-22 SMART
CA 472 558 1.65e-25 SMART
CA 588 669 6.24e-12 SMART
Pfam:Cadherin_C_2 685 768 4.7e-26 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.4%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,274,626 S1323T possibly damaging Het
4930444G20Rik C A 10: 22,067,755 G109C probably damaging Het
5830473C10Rik A G 5: 90,577,793 N288S probably benign Het
Ap4b1 T A 3: 103,812,214 D81E probably benign Het
Atg16l1 A T 1: 87,774,356 probably null Het
Atp11a A G 8: 12,856,949 T459A probably damaging Het
AU019823 T A 9: 50,610,310 I104L probably benign Het
BC049762 C T 11: 51,253,981 D158N probably damaging Het
BC055324 A G 1: 163,986,885 probably null Het
Bloc1s5 T A 13: 38,631,064 I40F probably damaging Het
Capn5 T A 7: 98,129,254 Q386L probably damaging Het
Cbfa2t2 C T 2: 154,534,983 H529Y probably damaging Het
Cd3d T C 9: 44,985,859 probably benign Het
Cenpa A G 5: 30,672,462 probably null Het
Chit1 A T 1: 134,149,425 Y322F probably null Het
Cntnap5c T A 17: 58,092,350 N399K possibly damaging Het
Dock8 A T 19: 25,095,606 T417S probably benign Het
Fkbp2 A G 19: 6,979,169 Het
Fsip1 G A 2: 118,249,913 R121C probably benign Het
Gbp2b T C 3: 142,600,559 I131T probably benign Het
Gm10093 A G 17: 78,492,914 T445A possibly damaging Het
Gm12695 T C 4: 96,769,816 N39D probably benign Het
Gm13089 A T 4: 143,699,106 I89N probably benign Het
Gm4922 T C 10: 18,783,868 R369G probably damaging Het
Gpatch3 C T 4: 133,582,525 L390F probably damaging Het
Gpd2 G A 2: 57,355,788 M443I probably damaging Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Jph3 A G 8: 121,753,371 T263A possibly damaging Het
Me3 C A 7: 89,845,885 A337E probably damaging Het
Mndal A C 1: 173,884,698 probably null Het
Muc6 C T 7: 141,637,540 E2342K possibly damaging Het
Neb A G 2: 52,186,064 V5659A probably damaging Het
Nrxn1 G A 17: 91,088,233 A165V probably benign Het
Olfr1442 T A 19: 12,675,045 I280N possibly damaging Het
Olfr1447 T C 19: 12,901,312 N156S probably benign Het
Orc2 A G 1: 58,500,375 L35S probably benign Het
Pax4 A G 6: 28,447,119 probably null Het
Pla2r1 C T 2: 60,514,966 E349K probably benign Het
Polr2a C T 11: 69,735,961 A1516T probably benign Het
Prpf38a G T 4: 108,570,204 D187E possibly damaging Het
Rdh16f1 T A 10: 127,788,868 probably null Het
S100z T A 13: 95,478,582 D25V probably damaging Het
Scamp2 T G 9: 57,581,612 F199V probably damaging Het
Senp2 T G 16: 22,011,576 probably benign Het
Sltm T A 9: 70,574,610 S365T probably damaging Het
Smg6 C G 11: 74,929,343 P147A possibly damaging Het
Spem2 T A 11: 69,817,777 R121W probably damaging Het
Sufu A G 19: 46,450,966 probably null Het
Syt2 T C 1: 134,746,763 V313A possibly damaging Het
Tet2 C T 3: 133,479,341 probably null Het
Tfeb T A 17: 47,786,983 I232N probably benign Het
Ticrr T G 7: 79,691,853 I1062M probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vrk2 G A 11: 26,489,893 A226V probably damaging Het
Wnk1 A T 6: 119,965,678 probably benign Het
Xpo4 G T 14: 57,603,711 T505K probably benign Het
Yy1 A T 12: 108,793,668 I86F probably benign Het
Zc3h15 A G 2: 83,657,056 D73G possibly damaging Het
Other mutations in Pcdhb7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01668:Pcdhb7 APN 18 37343152 missense probably benign 0.35
IGL01806:Pcdhb7 APN 18 37342495 missense possibly damaging 0.60
IGL01862:Pcdhb7 APN 18 37343862 missense possibly damaging 0.81
IGL01961:Pcdhb7 APN 18 37342473 missense probably damaging 1.00
R0184:Pcdhb7 UTSW 18 37343390 missense probably benign 0.44
R0426:Pcdhb7 UTSW 18 37342804 missense probably damaging 0.99
R0576:Pcdhb7 UTSW 18 37342357 missense probably benign 0.01
R0646:Pcdhb7 UTSW 18 37343389 missense probably damaging 1.00
R0656:Pcdhb7 UTSW 18 37341901 missense probably benign 0.01
R1216:Pcdhb7 UTSW 18 37343874 missense probably damaging 0.99
R1851:Pcdhb7 UTSW 18 37342578 missense possibly damaging 0.69
R2168:Pcdhb7 UTSW 18 37343282 missense probably benign 0.05
R2312:Pcdhb7 UTSW 18 37342197 missense probably benign
R3153:Pcdhb7 UTSW 18 37343073 missense probably damaging 1.00
R3758:Pcdhb7 UTSW 18 37343026 missense possibly damaging 0.84
R3763:Pcdhb7 UTSW 18 37341883 missense probably benign
R3940:Pcdhb7 UTSW 18 37343968 missense probably damaging 1.00
R3949:Pcdhb7 UTSW 18 37343088 missense probably benign 0.00
R4418:Pcdhb7 UTSW 18 37343482 missense probably benign 0.08
R4580:Pcdhb7 UTSW 18 37342135 missense probably damaging 1.00
R4880:Pcdhb7 UTSW 18 37342231 missense probably benign 0.00
R4936:Pcdhb7 UTSW 18 37342149 nonsense probably null
R4936:Pcdhb7 UTSW 18 37342150 missense probably damaging 1.00
R5086:Pcdhb7 UTSW 18 37343109 missense possibly damaging 0.56
R5517:Pcdhb7 UTSW 18 37341793 intron probably benign
R5570:Pcdhb7 UTSW 18 37344171 missense probably benign 0.35
R5827:Pcdhb7 UTSW 18 37342024 missense probably benign 0.14
R6187:Pcdhb7 UTSW 18 37342569 missense probably benign 0.23
R6194:Pcdhb7 UTSW 18 37342146 missense probably damaging 0.98
R6195:Pcdhb7 UTSW 18 37342656 missense probably benign 0.33
R6373:Pcdhb7 UTSW 18 37342211 nonsense probably null
R6398:Pcdhb7 UTSW 18 37343434 missense possibly damaging 0.86
R6437:Pcdhb7 UTSW 18 37342690 missense probably damaging 0.96
R6587:Pcdhb7 UTSW 18 37344103 missense probably benign
R6596:Pcdhb7 UTSW 18 37343361 missense probably damaging 0.97
R6646:Pcdhb7 UTSW 18 37343974 missense possibly damaging 0.90
R6702:Pcdhb7 UTSW 18 37341906 missense probably benign 0.03
R6976:Pcdhb7 UTSW 18 37343578 missense probably benign 0.12
R7038:Pcdhb7 UTSW 18 37342204 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AGCCAGTGCAATATTTTCAAGG -3'
(R):5'- AGGGGCTGTTCACAAACTCAG -3'

Sequencing Primer
(F):5'- GATCATGCTCCAGAATTTCCAGAAGG -3'
(R):5'- GCTGTTCACAAACTCAGGAGCATTG -3'
Posted On2019-06-05