Incidental Mutation 'PIT4283001:Marf1'
ID554382
Institutional Source Beutler Lab
Gene Symbol Marf1
Ensembl Gene ENSMUSG00000060657
Gene Namemeiosis regulator and mRNA stability 1
Synonyms4921513D23Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.245) question?
Stock #PIT4283001 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location14109173-14163351 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 14128568 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 1230 (T1230S)
Ref Sequence ENSEMBL: ENSMUSP00000087770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090300]
Predicted Effect probably benign
Transcript: ENSMUST00000090300
AA Change: T1230S

PolyPhen 2 Score 0.222 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000087770
Gene: ENSMUSG00000060657
AA Change: T1230S

DomainStartEndE-ValueType
low complexity region 116 127 N/A INTRINSIC
low complexity region 290 305 N/A INTRINSIC
Pfam:NYN 351 492 1.5e-21 PFAM
RRM 511 579 3.17e-1 SMART
low complexity region 599 610 N/A INTRINSIC
RRM 790 864 4.47e-3 SMART
internal_repeat_2 871 914 1.57e-5 PROSPERO
low complexity region 944 960 N/A INTRINSIC
Pfam:OST-HTH 1096 1167 1e-11 PFAM
low complexity region 1181 1186 N/A INTRINSIC
Pfam:OST-HTH 1256 1328 1.2e-10 PFAM
Pfam:OST-HTH 1332 1404 2.4e-10 PFAM
Pfam:OST-HTH 1408 1480 6.8e-13 PFAM
Pfam:OST-HTH 1483 1555 3e-14 PFAM
low complexity region 1682 1701 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.2%
  • 3x: 91.1%
  • 10x: 86.5%
  • 20x: 76.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a putative peroxisomal protein that appears to be conserved across Euteleostomi. In humans, it may be autoantigenic. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit female infertility with abnormalities in oogenic processes including meiotic progression, genomic integrity and acquisition of developmental competence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A G 6: 96,165,715 I116T probably benign Het
2610028H24Rik A C 10: 76,449,259 M1L probably benign Het
Aacs C A 5: 125,484,655 A119D probably damaging Het
Abcb1b T A 5: 8,813,693 V216D probably damaging Het
Adap2 T A 11: 80,177,263 L367H probably damaging Het
Adcy7 T A 8: 88,315,492 M373K probably damaging Het
Arhgap31 A G 16: 38,608,992 L507P probably damaging Het
Brinp3 C T 1: 146,901,423 T536I probably damaging Het
Cacna1b T C 2: 24,631,941 D1718G probably damaging Het
Cacna2d1 A C 5: 16,302,294 Y347S probably benign Het
Carf C A 1: 60,128,002 P165T probably benign Het
Dnaaf5 A G 5: 139,166,162 T523A probably benign Het
Dnajc10 T C 2: 80,331,395 S326P probably benign Het
Eif4enif1 A T 11: 3,234,464 E528D probably damaging Het
Elp2 G A 18: 24,622,130 D392N probably damaging Het
Fat1 T C 8: 45,029,540 S3079P probably damaging Het
Fat1 G T 8: 45,037,207 V3719F probably damaging Het
Fat3 T A 9: 16,006,601 S1509C possibly damaging Het
Frmpd4 C T X: 167,729,034 R8H possibly damaging Het
Fuk A G 8: 110,887,432 V693A probably benign Het
Glud1 T A 14: 34,336,172 I380N probably damaging Het
Gnl2 A G 4: 125,046,306 S324G probably damaging Het
Gramd1b C T 9: 40,455,456 G72D probably benign Het
Gramd3 A T 18: 56,489,663 E299V probably damaging Het
Grin1 C T 2: 25,297,852 R544H probably damaging Het
Ifitm7 A T 16: 13,983,607 V96E probably damaging Het
Lman1l T C 9: 57,616,076 E66G probably damaging Het
Lsm14b T A 2: 180,032,543 M293K probably benign Het
Morc2b T A 17: 33,136,068 H910L probably benign Het
Mylip A G 13: 45,406,634 N247S possibly damaging Het
Olfr1246 T C 2: 89,590,228 M296V probably benign Het
Osbpl3 T C 6: 50,346,088 S264G probably benign Het
Pds5b C T 5: 150,778,309 R802W probably damaging Het
Pik3cg T C 12: 32,205,865 E41G probably damaging Het
Plk3 A G 4: 117,133,292 I112T probably damaging Het
Pwp2 A G 10: 78,185,087 M1T probably null Het
Rtel1 T C 2: 181,346,890 I417T probably benign Het
Sirt1 A T 10: 63,321,786 N616K probably benign Het
Sirt6 T C 10: 81,622,418 S334G possibly damaging Het
Strc T C 2: 121,375,307 Y827C probably damaging Het
Taf1b T C 12: 24,547,595 Y385H possibly damaging Het
Tgm5 T C 2: 121,071,585 E201G possibly damaging Het
Thbd G C 2: 148,407,083 N288K probably benign Het
Ush2a T A 1: 188,436,867 N1068K probably benign Het
Vmn2r52 T C 7: 10,170,829 E361G possibly damaging Het
Vps13d T C 4: 145,108,588 N2736S Het
Vwa5b1 A G 4: 138,600,263 L334P probably damaging Het
Zan A G 5: 137,400,093 S4226P unknown Het
Zdhhc24 T C 19: 4,878,750 M1T probably null Het
Other mutations in Marf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Marf1 APN 16 14115742 missense possibly damaging 0.49
IGL00933:Marf1 APN 16 14117357 missense probably damaging 1.00
IGL01101:Marf1 APN 16 14146736 missense possibly damaging 0.85
IGL02140:Marf1 APN 16 14141912 missense probably damaging 0.99
IGL03196:Marf1 APN 16 14140259 missense possibly damaging 0.64
R0016:Marf1 UTSW 16 14152265 missense probably damaging 0.99
R0016:Marf1 UTSW 16 14152265 missense probably damaging 0.99
R0046:Marf1 UTSW 16 14111727 missense possibly damaging 0.83
R0046:Marf1 UTSW 16 14111727 missense possibly damaging 0.83
R0056:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0057:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0058:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0058:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0113:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0115:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0179:Marf1 UTSW 16 14151176 missense probably damaging 1.00
R0238:Marf1 UTSW 16 14151283 missense probably benign 0.00
R0238:Marf1 UTSW 16 14151283 missense probably benign 0.00
R0294:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0295:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0316:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0318:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0375:Marf1 UTSW 16 14151320 splice site probably benign
R0383:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0391:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0504:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0589:Marf1 UTSW 16 14142055 splice site probably benign
R0603:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0610:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R1240:Marf1 UTSW 16 14146762 missense possibly damaging 0.48
R1445:Marf1 UTSW 16 14115824 missense probably benign
R1716:Marf1 UTSW 16 14142586 missense possibly damaging 0.95
R1921:Marf1 UTSW 16 14128601 missense possibly damaging 0.63
R2098:Marf1 UTSW 16 14114200 missense probably benign 0.00
R2155:Marf1 UTSW 16 14132429 missense probably damaging 0.99
R2177:Marf1 UTSW 16 14152607 missense probably benign 0.01
R2195:Marf1 UTSW 16 14111699 missense probably benign
R2410:Marf1 UTSW 16 14115827 missense probably benign 0.02
R2999:Marf1 UTSW 16 14142641 missense possibly damaging 0.60
R3000:Marf1 UTSW 16 14142641 missense possibly damaging 0.60
R3147:Marf1 UTSW 16 14125979 missense possibly damaging 0.64
R3148:Marf1 UTSW 16 14125979 missense possibly damaging 0.64
R3430:Marf1 UTSW 16 14140177 unclassified probably benign
R3821:Marf1 UTSW 16 14142554 missense probably damaging 1.00
R4383:Marf1 UTSW 16 14142641 missense possibly damaging 0.60
R4384:Marf1 UTSW 16 14142641 missense possibly damaging 0.60
R4520:Marf1 UTSW 16 14132666 missense probably damaging 0.98
R4554:Marf1 UTSW 16 14153977 start gained probably benign
R4557:Marf1 UTSW 16 14153977 start gained probably benign
R4768:Marf1 UTSW 16 14131597 missense possibly damaging 0.93
R4784:Marf1 UTSW 16 14152457 missense probably benign
R4857:Marf1 UTSW 16 14128611 nonsense probably null
R4863:Marf1 UTSW 16 14132665 missense possibly damaging 0.60
R4994:Marf1 UTSW 16 14114231 missense probably benign
R5191:Marf1 UTSW 16 14146078 missense probably damaging 1.00
R5503:Marf1 UTSW 16 14152231 missense probably damaging 0.99
R5813:Marf1 UTSW 16 14152585 missense probably benign 0.35
R5905:Marf1 UTSW 16 14127249 missense probably damaging 0.99
R5960:Marf1 UTSW 16 14152417 missense probably damaging 0.98
R6104:Marf1 UTSW 16 14117455 missense probably damaging 0.99
R6387:Marf1 UTSW 16 14141640 makesense probably null
R6533:Marf1 UTSW 16 14115799 missense probably benign 0.16
R6608:Marf1 UTSW 16 14132714 missense probably damaging 1.00
R6642:Marf1 UTSW 16 14132747 missense probably benign 0.02
R6954:Marf1 UTSW 16 14138520 missense probably damaging 1.00
R6994:Marf1 UTSW 16 14128857 missense probably damaging 1.00
R7010:Marf1 UTSW 16 14137001 missense probably damaging 0.99
R7090:Marf1 UTSW 16 14111702 missense possibly damaging 0.52
R7174:Marf1 UTSW 16 14136953 missense probably damaging 1.00
R7221:Marf1 UTSW 16 14142485 missense probably damaging 1.00
R7247:Marf1 UTSW 16 14127093 missense probably damaging 1.00
U24488:Marf1 UTSW 16 14132366 nonsense probably null
X0025:Marf1 UTSW 16 14114278 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCTTCTTCCAGAGAACACAG -3'
(R):5'- AGCAAGCAGGTCATCGTGAG -3'

Sequencing Primer
(F):5'- CTTCTTCCAGAGAACACAGGTAATG -3'
(R):5'- CGTGAGAGACTTTTCACAGGC -3'
Posted On2019-06-07