Incidental Mutation 'PIT4283001:Arhgap31'
ID554383
Institutional Source Beutler Lab
Gene Symbol Arhgap31
Ensembl Gene ENSMUSG00000022799
Gene NameRho GTPase activating protein 31
SynonymsCdGAP
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.322) question?
Stock #PIT4283001 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location38598340-38713274 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38608992 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 507 (L507P)
Ref Sequence ENSEMBL: ENSMUSP00000023487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023487]
Predicted Effect probably damaging
Transcript: ENSMUST00000023487
AA Change: L507P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023487
Gene: ENSMUSG00000022799
AA Change: L507P

DomainStartEndE-ValueType
RhoGAP 32 213 1.04e-60 SMART
low complexity region 291 303 N/A INTRINSIC
low complexity region 503 522 N/A INTRINSIC
low complexity region 670 683 N/A INTRINSIC
low complexity region 722 733 N/A INTRINSIC
low complexity region 766 786 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.2%
  • 3x: 91.1%
  • 10x: 86.5%
  • 20x: 76.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTPase-activating protein (GAP). A variety of cellular processes are regulated by Rho GTPases which cycle between an inactive form bound to GDP and an active form bound to GTP. This cycling between inactive and active forms is regulated by guanine nucleotide exchange factors and GAPs. The encoded protein is a GAP shown to regulate two GTPases involved in protein trafficking and cell growth. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A G 6: 96,165,715 I116T probably benign Het
2610028H24Rik A C 10: 76,449,259 M1L probably benign Het
Aacs C A 5: 125,484,655 A119D probably damaging Het
Abcb1b T A 5: 8,813,693 V216D probably damaging Het
Adap2 T A 11: 80,177,263 L367H probably damaging Het
Adcy7 T A 8: 88,315,492 M373K probably damaging Het
Brinp3 C T 1: 146,901,423 T536I probably damaging Het
Cacna1b T C 2: 24,631,941 D1718G probably damaging Het
Cacna2d1 A C 5: 16,302,294 Y347S probably benign Het
Carf C A 1: 60,128,002 P165T probably benign Het
Dnaaf5 A G 5: 139,166,162 T523A probably benign Het
Dnajc10 T C 2: 80,331,395 S326P probably benign Het
Eif4enif1 A T 11: 3,234,464 E528D probably damaging Het
Elp2 G A 18: 24,622,130 D392N probably damaging Het
Fat1 T C 8: 45,029,540 S3079P probably damaging Het
Fat1 G T 8: 45,037,207 V3719F probably damaging Het
Fat3 T A 9: 16,006,601 S1509C possibly damaging Het
Frmpd4 C T X: 167,729,034 R8H possibly damaging Het
Fuk A G 8: 110,887,432 V693A probably benign Het
Glud1 T A 14: 34,336,172 I380N probably damaging Het
Gnl2 A G 4: 125,046,306 S324G probably damaging Het
Gramd1b C T 9: 40,455,456 G72D probably benign Het
Gramd3 A T 18: 56,489,663 E299V probably damaging Het
Grin1 C T 2: 25,297,852 R544H probably damaging Het
Ifitm7 A T 16: 13,983,607 V96E probably damaging Het
Lman1l T C 9: 57,616,076 E66G probably damaging Het
Lsm14b T A 2: 180,032,543 M293K probably benign Het
Marf1 T A 16: 14,128,568 T1230S probably benign Het
Morc2b T A 17: 33,136,068 H910L probably benign Het
Mylip A G 13: 45,406,634 N247S possibly damaging Het
Olfr1246 T C 2: 89,590,228 M296V probably benign Het
Osbpl3 T C 6: 50,346,088 S264G probably benign Het
Pds5b C T 5: 150,778,309 R802W probably damaging Het
Pik3cg T C 12: 32,205,865 E41G probably damaging Het
Plk3 A G 4: 117,133,292 I112T probably damaging Het
Pwp2 A G 10: 78,185,087 M1T probably null Het
Rtel1 T C 2: 181,346,890 I417T probably benign Het
Sirt1 A T 10: 63,321,786 N616K probably benign Het
Sirt6 T C 10: 81,622,418 S334G possibly damaging Het
Strc T C 2: 121,375,307 Y827C probably damaging Het
Taf1b T C 12: 24,547,595 Y385H possibly damaging Het
Tgm5 T C 2: 121,071,585 E201G possibly damaging Het
Thbd G C 2: 148,407,083 N288K probably benign Het
Ush2a T A 1: 188,436,867 N1068K probably benign Het
Vmn2r52 T C 7: 10,170,829 E361G possibly damaging Het
Vps13d T C 4: 145,108,588 N2736S Het
Vwa5b1 A G 4: 138,600,263 L334P probably damaging Het
Zan A G 5: 137,400,093 S4226P unknown Het
Zdhhc24 T C 19: 4,878,750 M1T probably null Het
Other mutations in Arhgap31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00741:Arhgap31 APN 16 38603001 missense probably damaging 1.00
IGL01062:Arhgap31 APN 16 38601456 missense probably damaging 1.00
IGL01152:Arhgap31 APN 16 38602239 missense possibly damaging 0.49
IGL01680:Arhgap31 APN 16 38603614 missense probably benign 0.04
IGL01739:Arhgap31 APN 16 38603431 missense probably benign
IGL01870:Arhgap31 APN 16 38618242 missense probably damaging 1.00
IGL01936:Arhgap31 APN 16 38602925 missense probably damaging 1.00
IGL01981:Arhgap31 APN 16 38601573 missense probably damaging 1.00
IGL01983:Arhgap31 APN 16 38601765 missense probably damaging 1.00
IGL02157:Arhgap31 APN 16 38623901 missense probably damaging 1.00
IGL02629:Arhgap31 APN 16 38609164 missense probably benign 0.00
IGL03375:Arhgap31 APN 16 38602828 missense probably damaging 1.00
R0271:Arhgap31 UTSW 16 38602510 missense possibly damaging 0.61
R1325:Arhgap31 UTSW 16 38602942 missense probably benign 0.00
R1753:Arhgap31 UTSW 16 38601612 missense possibly damaging 0.92
R1766:Arhgap31 UTSW 16 38625590 missense probably damaging 1.00
R1834:Arhgap31 UTSW 16 38603703 missense probably benign 0.02
R2104:Arhgap31 UTSW 16 38625579 missense probably benign 0.03
R2261:Arhgap31 UTSW 16 38609277 missense probably damaging 1.00
R3011:Arhgap31 UTSW 16 38601907 missense possibly damaging 0.58
R3712:Arhgap31 UTSW 16 38602533 missense possibly damaging 0.91
R3757:Arhgap31 UTSW 16 38637000 missense probably damaging 1.00
R3953:Arhgap31 UTSW 16 38603464 missense probably benign 0.00
R4105:Arhgap31 UTSW 16 38602426 missense probably damaging 1.00
R4107:Arhgap31 UTSW 16 38602426 missense probably damaging 1.00
R4108:Arhgap31 UTSW 16 38602426 missense probably damaging 1.00
R4109:Arhgap31 UTSW 16 38602426 missense probably damaging 1.00
R4198:Arhgap31 UTSW 16 38623913 missense probably damaging 1.00
R4200:Arhgap31 UTSW 16 38623913 missense probably damaging 1.00
R4273:Arhgap31 UTSW 16 38602335 missense possibly damaging 0.92
R5020:Arhgap31 UTSW 16 38603076 missense probably damaging 1.00
R5100:Arhgap31 UTSW 16 38601459 missense probably damaging 1.00
R6516:Arhgap31 UTSW 16 38609404 missense possibly damaging 0.47
R6879:Arhgap31 UTSW 16 38602314 missense probably benign
X0063:Arhgap31 UTSW 16 38602398 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CACCCCATGACCTTCTCACAGT -3'
(R):5'- GCAAATCTGTCTTCACAAGCAG -3'

Sequencing Primer
(F):5'- TGAGTACTTATACTGGACACCGC -3'
(R):5'- AAGCAGCCTGTTCCAGATG -3'
Posted On2019-06-07