Incidental Mutation 'PIT4243001:Abhd13'
ID554463
Institutional Source Beutler Lab
Gene Symbol Abhd13
Ensembl Gene ENSMUSG00000040396
Gene Nameabhydrolase domain containing 13
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4243001 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location9977707-9992155 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 9987967 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 188 (F188S)
Ref Sequence ENSEMBL: ENSMUSP00000036730 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048216] [ENSMUST00000139793]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048216
AA Change: F188S

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000036730
Gene: ENSMUSG00000040396
AA Change: F188S

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
transmembrane domain 39 58 N/A INTRINSIC
Pfam:Abhydrolase_5 116 299 5.6e-24 PFAM
Pfam:Abhydrolase_3 117 279 1.7e-6 PFAM
Pfam:Abhydrolase_6 117 310 4.9e-15 PFAM
Pfam:Abhydrolase_1 143 245 1.8e-8 PFAM
Pfam:AXE1 163 229 3.7e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000139793
AA Change: F188S

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000116130
Gene: ENSMUSG00000040396
AA Change: F188S

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
transmembrane domain 39 58 N/A INTRINSIC
Pfam:Hydrolase_4 111 250 2.5e-11 PFAM
Pfam:Abhydrolase_1 115 237 3.2e-11 PFAM
Pfam:Abhydrolase_5 116 299 6.3e-24 PFAM
Pfam:Abhydrolase_6 117 241 2.9e-8 PFAM
Pfam:AXE1 162 229 9.1e-8 PFAM
Coding Region Coverage
  • 1x: 92.7%
  • 3x: 90.5%
  • 10x: 85.2%
  • 20x: 74.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 87,972,140 E252V possibly damaging Het
Abtb1 A G 6: 88,838,726 V225A probably benign Het
Accs A G 2: 93,841,334 M237T probably benign Het
Adcy9 A G 16: 4,418,407 I380T probably damaging Het
Add3 T C 19: 53,236,690 S414P probably benign Het
Ak3 C T 19: 29,037,871 probably null Het
Atg14 T C 14: 47,554,574 E132G possibly damaging Het
Bcl2l11 A G 2: 128,147,106 E135G probably benign Het
Brwd1 G A 16: 96,002,671 Q2100* probably null Het
Card11 A C 5: 140,908,604 V90G possibly damaging Het
Celsr3 T C 9: 108,832,308 V1451A probably benign Het
Clip4 T C 17: 71,806,728 I291T probably damaging Het
Clk1 C T 1: 58,419,677 D179N probably damaging Het
Cyp11b2 A G 15: 74,851,453 L454P probably damaging Het
Cyp2a12 C A 7: 27,034,773 S377Y probably benign Het
Ep400 A G 5: 110,735,580 S663P unknown Het
Erich6 G A 3: 58,629,879 T238I possibly damaging Het
Herc1 T A 9: 66,372,207 H132Q probably benign Het
Hk2 A G 6: 82,730,877 C704R probably damaging Het
Ift74 A T 4: 94,686,904 R531W possibly damaging Het
Ism2 T C 12: 87,287,058 E71G probably benign Het
Lipe A C 7: 25,395,546 S22A probably benign Het
Myl10 A G 5: 136,694,293 D32G probably benign Het
Nomo1 A G 7: 46,044,281 H179R probably damaging Het
Olfr133 T C 17: 38,149,503 F305S probably benign Het
Olfr1378 T C 11: 50,969,552 F178S probably damaging Het
Pdpn T A 4: 143,270,538 T129S probably damaging Het
Pold1 C T 7: 44,542,158 V135I possibly damaging Het
Rasgrp3 T A 17: 75,500,139 N199K probably damaging Het
Skil T C 3: 31,113,565 S449P probably damaging Het
Spag16 T C 1: 69,853,381 L107P probably damaging Het
Tbccd1 A G 16: 22,822,337 M430T probably damaging Het
Tnfaip3 G A 10: 19,011,574 L68F probably damaging Het
Trrap G A 5: 144,796,971 R878H probably benign Het
Vasn T C 16: 4,649,616 S476P probably damaging Het
Vmn2r110 T A 17: 20,582,117 M499L probably benign Het
Wwp1 T C 4: 19,638,631 T571A probably damaging Het
Zfp608 C A 18: 54,898,024 G948V probably damaging Het
Zswim5 A G 4: 116,984,778 I852V probably benign Het
Other mutations in Abhd13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01783:Abhd13 APN 8 9987900 missense possibly damaging 0.86
R0242:Abhd13 UTSW 8 9987561 missense probably benign 0.00
R0242:Abhd13 UTSW 8 9987561 missense probably benign 0.00
R0350:Abhd13 UTSW 8 9987600 missense probably damaging 1.00
R1487:Abhd13 UTSW 8 9987402 start gained probably benign
R1906:Abhd13 UTSW 8 9988170 missense probably benign 0.11
R1907:Abhd13 UTSW 8 9988170 missense probably benign 0.11
R2901:Abhd13 UTSW 8 9988231 missense probably damaging 1.00
R3105:Abhd13 UTSW 8 9987931 missense probably benign 0.05
R3413:Abhd13 UTSW 8 9987387 splice site probably benign
R4569:Abhd13 UTSW 8 9988071 missense possibly damaging 0.94
R5586:Abhd13 UTSW 8 9988318 missense probably benign 0.23
R6373:Abhd13 UTSW 8 9988240 missense probably damaging 1.00
R6526:Abhd13 UTSW 8 9987777 missense probably damaging 1.00
R6776:Abhd13 UTSW 8 9988075 missense probably benign 0.03
R7315:Abhd13 UTSW 8 9987970 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACGCACTGCTAATGCTGG -3'
(R):5'- ATCAACTGGTCAGAGAGGCC -3'

Sequencing Primer
(F):5'- ACTGCTAATGCTGGTGAACC -3'
(R):5'- CATCCTGCACTGGGAGATC -3'
Posted On2019-06-07