Incidental Mutation 'PIT4260001:Pou3f2'
ID554489
Institutional Source Beutler Lab
Gene Symbol Pou3f2
Ensembl Gene ENSMUSG00000095139
Gene NamePOU domain, class 3, transcription factor 2
SynonymsOtf7, Brn-2, Brn2, A230098E07Rik, 9430075J19Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4260001 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location22482780-22488366 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 22487291 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 281 (Q281K)
Ref Sequence ENSEMBL: ENSMUSP00000136147 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178174]
Predicted Effect possibly damaging
Transcript: ENSMUST00000178174
AA Change: Q281K

PolyPhen 2 Score 0.590 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000136147
Gene: ENSMUSG00000095139
AA Change: Q281K

DomainStartEndE-ValueType
coiled coil region 122 152 N/A INTRINSIC
low complexity region 158 169 N/A INTRINSIC
low complexity region 220 261 N/A INTRINSIC
POU 264 338 9.06e-54 SMART
HOX 356 418 4.2e-20 SMART
Coding Region Coverage
  • 1x: 92.7%
  • 3x: 90.5%
  • 10x: 84.8%
  • 20x: 72.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the POU-III class of neural transcription factors. The encoded protein is involved in neuronal differentiation and enhances the activation of corticotropin-releasing hormone regulated genes. Overexpression of this protein is associated with an increase in the proliferation of melanoma cells. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygous mutation of this gene results in lethality by 10 days of age. Mutant animals are growth retarded, have hyperkeratotic, flaky skin, and exhibit loss of the posterior pituitary and disruption of late endocrine hypothalamic development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap3 A T 18: 37,996,895 L71Q probably benign Het
Atp10a A T 7: 58,791,118 K504* probably null Het
AW551984 T C 9: 39,592,979 T564A probably benign Het
Cep128 A G 12: 91,299,034 V268A probably benign Het
Clgn T C 8: 83,423,124 M418T probably damaging Het
Col12a1 A G 9: 79,651,380 probably null Het
Col4a3 A T 1: 82,682,761 E933D unknown Het
Csmd1 A T 8: 16,070,313 L1826Q probably damaging Het
Enpp2 C T 15: 54,844,378 probably null Het
Ep400 G A 5: 110,693,171 R1832* probably null Het
Exoc5 T C 14: 49,048,765 K135R probably benign Het
Fam83h A G 15: 76,001,897 F1197S probably damaging Het
Gabrg1 T C 5: 70,782,280 I170V probably benign Het
Gigyf2 C T 1: 87,419,106 R610C unknown Het
Gm16440 T C 14: 6,388,301 E119G probably benign Het
Gm17669 A G 18: 67,562,438 R18G probably damaging Het
Gxylt1 A G 15: 93,261,827 S100P probably damaging Het
Hacd4 C G 4: 88,398,105 R259T unknown Het
Hacd4 T A 4: 88,398,106 R259* probably null Het
Hist1h3h C A 13: 21,717,919 S87R possibly damaging Het
Hivep3 T C 4: 120,099,182 L1565P probably damaging Het
Iqsec1 T A 6: 90,690,489 D218V probably damaging Het
Matn2 C T 15: 34,428,731 T747I possibly damaging Het
Myl6b T A 10: 128,496,306 Q97L possibly damaging Het
Olfr73 A T 2: 88,034,782 M119K probably damaging Het
Pcdh1 A G 18: 38,203,366 V72A probably damaging Het
Pira2 C T 7: 3,842,170 S363N probably benign Het
Pira2 G C 7: 3,842,173 T362S probably benign Het
Pira2 T C 7: 3,842,174 T362A probably benign Het
Pkhd1 A G 1: 20,222,906 V2830A possibly damaging Het
Plpp1 A G 13: 112,856,885 D118G probably damaging Het
Polr2a A G 11: 69,735,967 S1514P possibly damaging Het
Prl7a2 A T 13: 27,659,276 Y181* probably null Het
Prpf4b T A 13: 34,884,291 S368T probably benign Het
Prss45 A G 9: 110,838,445 D53G probably benign Het
Ryr2 T A 13: 11,594,755 H4395L possibly damaging Het
Spp2 G T 1: 88,411,205 A97S probably benign Het
Strn4 T C 7: 16,822,509 F99S probably damaging Het
Tcaf2 T A 6: 42,642,805 H96L probably damaging Het
Tenm2 T C 11: 36,163,730 D601G probably damaging Het
Trpm6 A T 19: 18,825,802 M870L possibly damaging Het
Ttn T C 2: 76,943,225 T2351A unknown Het
Xirp2 T A 2: 67,511,597 I1394K possibly damaging Het
Zfc3h1 G T 10: 115,390,889 D284Y probably damaging Het
Other mutations in Pou3f2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02325:Pou3f2 APN 4 22487020 missense probably damaging 1.00
R0141:Pou3f2 UTSW 4 22487210 missense possibly damaging 0.91
R0739:Pou3f2 UTSW 4 22486960 missense possibly damaging 0.88
R1054:Pou3f2 UTSW 4 22487536 missense possibly damaging 0.85
R1163:Pou3f2 UTSW 4 22487697 small deletion probably benign
R1351:Pou3f2 UTSW 4 22487162 missense probably damaging 0.99
R1482:Pou3f2 UTSW 4 22486960 missense possibly damaging 0.83
R1708:Pou3f2 UTSW 4 22487255 missense possibly damaging 0.85
R1865:Pou3f2 UTSW 4 22486917 nonsense probably null
R1918:Pou3f2 UTSW 4 22487119 missense probably damaging 0.98
R1919:Pou3f2 UTSW 4 22487119 missense probably damaging 0.98
R2071:Pou3f2 UTSW 4 22488076 missense probably benign 0.07
R4985:Pou3f2 UTSW 4 22487588 missense probably benign 0.26
R5210:Pou3f2 UTSW 4 22487324 missense probably damaging 1.00
R6174:Pou3f2 UTSW 4 22486960 missense possibly damaging 0.88
R7134:Pou3f2 UTSW 4 22486874 missense probably benign 0.00
R7197:Pou3f2 UTSW 4 22487288 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGAGTCTGCCTCTTCCAAC -3'
(R):5'- TATTCGCAGCCGAGCTTCAC -3'

Sequencing Primer
(F):5'- CCACTTGTTCAACAAAGGCTTCAG -3'
(R):5'- CCGAGCTTCACGGTGAAC -3'
Posted On2019-06-07